jruby · Apr 30, 2015 · May 1, 2015 · May 1, 2015 · May 1, 2015 · May 1, 2015
Showing 6,453 changed files with 319,345 additions and 145,696 deletions.
diff --git a/.gitignore b/.gitignore
@@ -13,6 +13,9 @@
 *.versionsBackup
 *.zip
 *~
+*.tokens
+*.su
+*.ll
 
 .DS_Store
 .debug.properties
@@ -21,6 +24,9 @@
 build
 build.properties
 build_graph.png
+mx*/*pyc
+mx*/env
+mxbuild
 core/src/main/java/org/jruby/runtime/Constants.java
 dependency-reduced-pom.xml
 dev_null
@@ -43,11 +49,14 @@ lib/ruby/gems
 lib/ruby/stdlib/*jopenssl*.jar
 lib/ruby/stdlib/bcpkix-jdk15on-*.jar
 lib/ruby/stdlib/bcprov-jdk15on-*.jar
+lib/ruby/stdlib/did_you_mean*
 lib/ruby/stdlib/gauntlet_rdoc.rb
 lib/ruby/stdlib/jar*
 lib/ruby/stdlib/jline
 lib/ruby/stdlib/jopenssl*
 lib/ruby/stdlib/krypt*
+lib/ruby/stdlib/net-telnet.rb
+lib/ruby/stdlib/net/telnet*
 lib/ruby/stdlib/openssl*
 lib/ruby/stdlib/org/
 lib/ruby/stdlib/readline/*readline*.jar
@@ -70,6 +79,7 @@ test/prawn
 test/rails
 test/testapp/testapp
 test/truffle/*.methods
+test/truffle/integration/gem-testing
 tool/nailgun/Makefile
 tool/nailgun/config.log
 tool/nailgun/config.status
@@ -78,6 +88,7 @@ reference.txt
 rubyspec_temp
 .polyglot.pom.rb
 tool/truffle/jruby_truffle_runner/jruby+truffle_runner-*.gem
+test/truffle/cexts/**/Makefile
 
 # binaries
 !bin/gem

diff --git a/.mvn/extensions.xml b/.mvn/extensions.xml
@@ -3,6 +3,6 @@
   <extension>
     <groupId>io.takari.polyglot</groupId>
     <artifactId>polyglot-ruby</artifactId>
-    <version>0.1.11</version>
+    <version>0.1.15</version>
   </extension>
 </extensions>
diff --git a/.mvn/wrapper/maven-wrapper.properties b/.mvn/wrapper/maven-wrapper.properties
@@ -1 +1 @@
-distributionUrl=https://repo1.maven.org/maven2/org/apache/maven/apache-maven/3.3.1/apache-maven-3.3.1-bin.zip
+distributionUrl=https://repo1.maven.org/maven2/org/apache/maven/apache-maven/3.3.9/apache-maven-3.3.9-bin.zip
diff --git a/.travis.yml b/.travis.yml
@@ -2,15 +2,18 @@ language: java
 
 sudo: false
 
-#cache:
-#  directories:
-#    - $HOME/.m2
+cache:
+ directories:
+   - $HOME/.m2
 
-before_script:
+before_install:
   - export MAVEN_SKIP_RC=true
-  - export MAVEN_OPTS="-Xmx512m -XX:MaxPermSize=512m"
+  - mvn -Xmx32M -v | grep 1.7.0; if [ $? = 0 ]; then export MAVEN_OPTS="-XX:MaxPermSize=240M"; else export MAVEN_OPTS="-XX:MaxMetaspaceSize=240M -XX:CompressedClassSpaceSize=240M"; fi
+  - export MAVEN_OPTS="-Xmx512M $MAVEN_OPTS"
+
+before_script:
   - unset GEM_PATH GEM_HOME IRBRC JRUBY_OPTS
-  - "export PATH=`pwd`/bin:$PATH"
+  - export PATH="`pwd`/bin:$PATH"
   - echo $HOME
 
 jdk:
@@ -22,29 +25,27 @@ os:
 
 env:
   global:
-    - JAVA_OPTS="-XX:+TieredCompilation -XX:TieredStopAtLevel=1"
+    - JAVA_OPTS="-XX:+TieredCompilation -XX:TieredStopAtLevel=1 -Xmn48M -Xmx512M"
     - MALLOC_ARENA_MAX=2
   matrix:
     - PHASE='-Ptest'
     - PHASE='-Prake -Dtask=test:jruby'
+    - PHASE='-Prake -Dtask=test:jruby:fullint'
     - PHASE='-Prake -Dtask=test:jruby:jit'
     - PHASE='-Prake -Dtask=test:mri'
+    - PHASE='-Prake -Dtask=test:mri:fullint'
     - PHASE='-Prake -Dtask=test:mri:jit'
     - PHASE='-Prake -Dtask=test:slow_suites'
     - PHASE='-Prake -Dtask=test:tracing'
     - PHASE='-Prake -Dtask=spec:ji'
     - PHASE='-Prake -Dtask=spec:compiler'
+    - PHASE='-Prake -Dtask=spec:compiler' JRUBY_OPTS=-Xcompile.invokedynamic
     - PHASE='-Prake -Dtask=spec:ffi'
     - PHASE='-Prake -Dtask=spec:regression'
     - PHASE='-Prake -Dtask=spec:ruby:fast'
     - PHASE='-Prake -Dtask=spec:jruby'
     - PHASE='-Prake -Dtask=spec:jrubyc'
     - PHASE='-Prake -Dtask=spec:profiler'
-    - PHASE='-Ptruffle-specs-language'
-    - PHASE='-Ptruffle-specs-core'
-    - PHASE='-Ptruffle-specs-library'
-    - PHASE='-Ptruffle-specs-truffle'
-    - PHASE='-Ptruffle-mri-tests'
 
 matrix:
   include:
@@ -70,11 +71,41 @@ matrix:
       jdk: oraclejdk8
     - env: COMMAND=test/check_versions.sh
       jdk: oraclejdk8
-    - env: COMMAND=tool/truffle-findbugs.sh
+    # JRuby+Truffle needs Java 8
+    - env: JT='test specs :command_line'
+      jdk: oraclejdk8
+    - env: JT='test specs :language'
+      jdk: oraclejdk8
+    - env: JT='test specs :core'
+      jdk: oraclejdk8
+    - env: JT='test specs :library'
+      jdk: oraclejdk8
+    - env: JT='test specs :truffle'
       jdk: oraclejdk8
-    - env: COMMAND='ruby tool/jt.rb check_ambiguous_arguments'
+    - env: JT='test integration'
       jdk: oraclejdk8
-    - env: COMMAND=test/truffle/integration-tests.sh
+    - env:
+      - COMMAND=test/truffle/gems/install-gems.sh
+      - JT='test gems'
+      jdk: oraclejdk8
+    - env:
+      - JAVA_OPTS="$JAVA_OPTS -Xmx512m"
+      - HAS_REDIS=true
+      - JT='test ecosystem'
+      jdk: oraclejdk8
+    - env: JT='test tck'
+      jdk: oraclejdk8
+    - env:
+      - JT=check_ambiguous_arguments
+      - SKIP_BUILD=true
+      jdk: oraclejdk8
+    - env:
+      - USE_BUILD_PACK=yes
+      - JT='test fast'
+      jdk: oraclejdk8
+  allow_failures:
+    - env: PHASE='-Prake -Dtask=test:mri:fullint'
+    - env: JT='test mri'
       jdk: oraclejdk8
     # NOTE: build seems to never start (waited for any to finish for more than a day) - probably a travis-ci bug
     #- env: PHASE='-Pmain'
@@ -83,16 +114,8 @@ matrix:
     #  group: edge
     #  jdk: oraclejdk9
 
-branches:
-  only:
-    - master
-    - jruby-1_7
-    - truffle-head
-    - /^test-.*$/
-    - /^ha-feature/
-
-script: if [[ -v COMMAND ]]; then $COMMAND; else ./mvnw install -Dinvoker.skip=false $PHASE | egrep -v 'Download|\\[exec\\] [[:digit:]]+/[[:digit:]]+|^[[:space:]]*\\[exec\\][[:space:]]*$' ; [ ${PIPESTATUS[0]} == 0 ]; fi
-install: travis_retry ./mvnw -Pbootstrap clean install -Dinvoker.skip -Dmaven.test.skip
+install: tool/travis-install.sh
+script: tool/travis-script.sh
 
 notifications:
   irc:
@@ -111,3 +134,6 @@ notifications:
 # we are on a branch
     on_success: always
     on_failure: never
+
+services:
+  - redis-server
diff --git a/COPYING b/COPYING
@@ -1,4 +1,4 @@
-JRuby is Copyright (c) 2007-2015 The JRuby project, and is released
+JRuby is Copyright (c) 2007-2016 The JRuby project, and is released
 under a tri EPL/GPL/LGPL license. You can use it, redistribute it
 and/or modify it under the terms of the:
 
@@ -12,7 +12,7 @@ bytelist (http://github.com/jruby/bytelist),
 yydebug (http://svn.codehaus.org/jruby/trunk/jay/yydebug)
 are released under the same copyright/license.
 
-The Truffle component is copyright (c) 2013-2015 Oracle and/or its
+The Truffle component is copyright (c) 2013-2016 Oracle and/or its
 affiliates and is released under the same licenses.
 
 Some additional libraries distributed with JRuby are not covered by

diff --git a/ISSUE_TEMPLATE.md b/ISSUE_TEMPLATE.md
@@ -0,0 +1,20 @@
+### Environment
+
+Provide at least:
+* JRuby version (`jruby -v`) and command line (flags, JRUBY_OPTS, etc)
+* Operating system and platform (e.g. `uname -a`)
+
+Other relevant info you may wish to add:
+* Installed or activated gems
+* Application/framework version (e.g. Rails, Sinatra)
+* Environment variables
+
+### Expected Behavior
+
+* Describe your expectation of how JRuby should behave, perhaps by showing how CRuby/MRI behaves.
+* Provide an executable Ruby script or a link to an example repository.
+
+### Actual Behavior
+
+* Describe or show the actual behavior.
+* Provide text or screen capture showing the behavior.
diff --git a/README.md b/README.md
@@ -12,7 +12,7 @@ It aims to be a complete, correct and fast implementation of Ruby, at the same
 time as providing powerful new features such as concurrency without a
 [global-interpreter-lock](http://en.wikipedia.org/wiki/Global_Interpreter_Lock),
 true parallelism, and tight integration to the Java language to allow you to
-uses Java classes in your Ruby program and to allow JRuby to be embedded into a
+use Java classes in your Ruby program and to allow JRuby to be embedded into a
 Java application.
 
 You can use JRuby simply as a faster version of Ruby, you can use it to run Ruby
@@ -40,7 +40,7 @@ For [`rbenv`](https://github.com/sstephenson/rbenv) you will need the
 package manager can provide these. Then you can run:
 
 ```
-$ rbenv install jruby-9.0.0.0-dev
+$ rbenv install jruby-9.0.5.0
 ```
 
 For [`rvm`](https://rvm.io) you can simply do:

diff --git a/VERSION b/VERSION
@@ -1 +1 @@
-9.0.5.0-SNAPSHOT
+9.1.3.0-SNAPSHOT
diff --git a/appveyor.yml b/appveyor.yml
@@ -4,8 +4,6 @@ build: off
 
 environment:
   matrix:
-    - JAVA_HOME: C:\Program Files\Java\jdk1.7.0
-    - JAVA_HOME: C:\Program Files (x86)\Java\jdk1.7.0
     - JAVA_HOME: C:\Program Files\Java\jdk1.8.0
     - JAVA_HOME: C:\Program Files (x86)\Java\jdk1.8.0
 

diff --git a/bench/yarv/bm_app_answer.rb → bench/mri/bm_app_answer.rb b/bench/yarv/bm_app_answer.rb → bench/mri/bm_app_answer.rb
diff --git a/bench/mri/bm_app_aobench.rb b/bench/mri/bm_app_aobench.rb
@@ -0,0 +1,291 @@
+# AO render benchmark
+# Original program (C) Syoyo Fujita in Javascript (and other languages)
+#      https://code.google.com/p/aobench/
+# Ruby(yarv2llvm) version by Hideki Miura
+#
+
+IMAGE_WIDTH = 256
+IMAGE_HEIGHT = 256
+NSUBSAMPLES = 2
+NAO_SAMPLES = 8
+
+class Vec
+  def initialize(x, y, z)
+    @x = x
+    @y = y
+    @z = z
+  end
+
+  attr_accessor :x, :y, :z
+
+  def vadd(b)
+    Vec.new(@x + b.x, @y + b.y, @z + b.z)
+  end
+
+  def vsub(b)
+    Vec.new(@x - b.x, @y - b.y, @z - b.z)
+  end
+
+  def vcross(b)
+    Vec.new(@y * b.z - @z * b.y,
+            @z * b.x - @x * b.z,
+            @x * b.y - @y * b.x)
+  end
+
+  def vdot(b)
+    @x * b.x + @y * b.y + @z * b.z
+  end
+
+  def vlength
+    Math.sqrt(@x * @x + @y * @y + @z * @z)
+  end
+
+  def vnormalize
+    len = vlength
+    v = Vec.new(@x, @y, @z)
+    if len > 1.0e-17 then
+      v.x = v.x / len
+      v.y = v.y / len
+      v.z = v.z / len
+    end
+    v
+  end
+end
+
+
+class Sphere
+  def initialize(center, radius)
+    @center = center
+    @radius = radius
+  end
+
+  attr_reader :center, :radius
+
+  def intersect(ray, isect)
+    rs = ray.org.vsub(@center)
+    b = rs.vdot(ray.dir)
+    c = rs.vdot(rs) - (@radius * @radius)
+    d = b * b - c
+    if d > 0.0 then
+      t = - b - Math.sqrt(d)
+
+      if t > 0.0 and t < isect.t then
+        isect.t = t
+        isect.hit = true
+        isect.pl = Vec.new(ray.org.x + ray.dir.x * t,
+                          ray.org.y + ray.dir.y * t,
+                          ray.org.z + ray.dir.z * t)
+        n = isect.pl.vsub(@center)
+        isect.n = n.vnormalize
+      else
+        0.0
+      end
+    end
+    nil
+  end
+end
+
+class Plane
+  def initialize(p, n)
+    @p = p
+    @n = n
+  end
+
+  def intersect(ray, isect)
+    d = -@p.vdot(@n)
+    v = ray.dir.vdot(@n)
+    v0 = v
+    if v < 0.0 then
+      v0 = -v
+    end
+    if v0 < 1.0e-17 then
+      return
+    end
+
+    t = -(ray.org.vdot(@n) + d) / v
+
+    if t > 0.0 and t < isect.t then
+      isect.hit = true
+      isect.t = t
+      isect.n = @n
+      isect.pl = Vec.new(ray.org.x + t * ray.dir.x,
+                        ray.org.y + t * ray.dir.y,
+                        ray.org.z + t * ray.dir.z)
+    end
+    nil
+  end
+end
+
+class Ray
+  def initialize(org, dir)
+    @org = org
+    @dir = dir
+  end
+
+  attr_accessor :org, :dir
+end
+
+class Isect
+  def initialize
+    @t = 10000000.0
+    @hit = false
+    @pl = Vec.new(0.0, 0.0, 0.0)
+    @n = Vec.new(0.0, 0.0, 0.0)
+  end
+
+  attr_accessor :t, :hit, :pl, :n
+end
+
+def clamp(f)
+  i = f * 255.5
+  if i > 255.0 then
+    i = 255.0
+  end
+  if i < 0.0 then
+    i = 0.0
+  end
+  i.to_i
+end
+
+def otherBasis(basis, n)
+  basis[2] = Vec.new(n.x, n.y, n.z)
+  basis[1] = Vec.new(0.0, 0.0, 0.0)
+
+  if n.x < 0.6 and n.x > -0.6 then
+    basis[1].x = 1.0
+  elsif n.y < 0.6 and n.y > -0.6 then
+    basis[1].y = 1.0
+  elsif n.z < 0.6 and n.z > -0.6 then
+    basis[1].z = 1.0
+  else
+    basis[1].x = 1.0
+  end
+
+  basis[0] = basis[1].vcross(basis[2])
+  basis[0] = basis[0].vnormalize
+
+  basis[1] = basis[2].vcross(basis[0])
+  basis[1] = basis[1].vnormalize
+end
+
+class Scene
+  def initialize
+    @spheres = Array.new
+    @spheres[0] = Sphere.new(Vec.new(-2.0, 0.0, -3.5), 0.5)
+    @spheres[1] = Sphere.new(Vec.new(-0.5, 0.0, -3.0), 0.5)
+    @spheres[2] = Sphere.new(Vec.new(1.0, 0.0, -2.2), 0.5)
+    @plane = Plane.new(Vec.new(0.0, -0.5, 0.0), Vec.new(0.0, 1.0, 0.0))
+  end
+
+  def ambient_occlusion(isect)
+    basis = Array.new
+    otherBasis(basis, isect.n)
+
+    ntheta    = NAO_SAMPLES
+    nphi      = NAO_SAMPLES
+    eps       = 0.0001
+    occlusion = 0.0
+
+    p0 = Vec.new(isect.pl.x + eps * isect.n.x,
+                isect.pl.y + eps * isect.n.y,
+                isect.pl.z + eps * isect.n.z)
+    nphi.times do |j|
+      ntheta.times do |i|
+        r = rand
+        phi = 2.0 * 3.14159265 * rand
+        x = Math.cos(phi) * Math.sqrt(1.0 - r)
+        y = Math.sin(phi) * Math.sqrt(1.0 - r)
+        z = Math.sqrt(r)
+
+        rx = x * basis[0].x + y * basis[1].x + z * basis[2].x
+        ry = x * basis[0].y + y * basis[1].y + z * basis[2].y
+        rz = x * basis[0].z + y * basis[1].z + z * basis[2].z
+
+        raydir = Vec.new(rx, ry, rz)
+        ray = Ray.new(p0, raydir)
+
+        occisect = Isect.new
+        @spheres[0].intersect(ray, occisect)
+        @spheres[1].intersect(ray, occisect)
+        @spheres[2].intersect(ray, occisect)
+        @plane.intersect(ray, occisect)
+        if occisect.hit then
+          occlusion = occlusion + 1.0
+        else
+          0.0
+        end
+      end
+    end
+
+    occlusion = (ntheta.to_f * nphi.to_f - occlusion) / (ntheta.to_f * nphi.to_f)
+
+    Vec.new(occlusion, occlusion, occlusion)
+  end
+
+  def render(w, h, nsubsamples)
+    cnt = 0
+    nsf = nsubsamples.to_f
+    h.times do |y|
+      w.times do |x|
+        rad = Vec.new(0.0, 0.0, 0.0)
+
+        # Subsampling
+        nsubsamples.times do |v|
+          nsubsamples.times do |u|
+
+            cnt = cnt + 1
+            wf = w.to_f
+            hf = h.to_f
+            xf = x.to_f
+            yf = y.to_f
+            uf = u.to_f
+            vf = v.to_f
+
+            px = (xf + (uf / nsf) - (wf / 2.0)) / (wf / 2.0)
+            py = -(yf + (vf / nsf) - (hf / 2.0)) / (hf / 2.0)
+
+            eye = Vec.new(px, py, -1.0).vnormalize
+
+            ray = Ray.new(Vec.new(0.0, 0.0, 0.0), eye)
+
+            isect = Isect.new
+            @spheres[0].intersect(ray, isect)
+            @spheres[1].intersect(ray, isect)
+            @spheres[2].intersect(ray, isect)
+            @plane.intersect(ray, isect)
+            if isect.hit then
+              col = ambient_occlusion(isect)
+              rad.x = rad.x + col.x
+              rad.y = rad.y + col.y
+              rad.z = rad.z + col.z
+            end
+          end
+        end
+
+        r = rad.x / (nsf * nsf)
+        g = rad.y / (nsf * nsf)
+        b = rad.z / (nsf * nsf)
+        printf("%c", clamp(r))
+        printf("%c", clamp(g))
+        printf("%c", clamp(b))
+      end
+      nil
+    end
+
+    nil
+  end
+end
+
+alias printf_orig printf
+def printf *args
+end
+
+# File.open("ao.ppm", "w") do |fp|
+  printf("P6\n")
+  printf("%d %d\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  printf("255\n", IMAGE_WIDTH, IMAGE_HEIGHT)
+  Scene.new.render(IMAGE_WIDTH, IMAGE_HEIGHT, NSUBSAMPLES)
+# end
+
+undef printf
+alias printf printf_orig
diff --git a/bench/yarv/bm_app_erb.rb → bench/mri/bm_app_erb.rb b/bench/yarv/bm_app_erb.rb → bench/mri/bm_app_erb.rb
@@ -1,26 +1,26 @@
-#
-# Create many HTML strings with ERB.
-#
-
-require 'erb'
-
-data = DATA.read
-max = 5_000
-title = "hello world!"
-content = "hello world!\n" * 10
-
-max.times{
-  ERB.new(data).result(binding)
-}
-
-__END__
-
-<html>
-  <head> <%= title %> </head>
-  <body>
-    <h1> <%= title %> </h1>
-    <p>
-      <%= content %>
-    </p>
-  </body>
-</html>
+#
+# Create many HTML strings with ERB.
+#
+
+require 'erb'
+
+data = DATA.read
+max = 15_000
+title = "hello world!"
+content = "hello world!\n" * 10
+
+max.times{
+  ERB.new(data).result(binding)
+}
+
+__END__
+
+<html>
+  <head> <%= title %> </head>
+  <body>
+    <h1> <%= title %> </h1>
+    <p>
+      <%= content %>
+    </p>
+  </body>
+</html>
diff --git a/bench/yarv/bm_app_factorial.rb → bench/mri/bm_app_factorial.rb b/bench/yarv/bm_app_factorial.rb → bench/mri/bm_app_factorial.rb
@@ -6,6 +6,6 @@ def fact(n)
   end
 end
 
-8.times{
+100.times {
   fact(5000)
-}
+}
diff --git a/bench/yarv/bm_app_fib.rb → bench/mri/bm_app_fib.rb b/bench/yarv/bm_app_fib.rb → bench/mri/bm_app_fib.rb
diff --git a/bench/mri/bm_app_lc_fizzbuzz.rb b/bench/mri/bm_app_lc_fizzbuzz.rb
@@ -0,0 +1,52 @@
+#
+# FizzBuzz program using only lambda calculus
+#
+# This program is quoted from
+#   "Understanding Computation" by Tom Stuart
+#   http://computationbook.com/
+#
+# You can understand why this program works fine by reading this book.
+#
+
+solution = -> k { -> f { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][k][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> l { -> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[l][f[x]] } }] } }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[m][n]][-> x { -> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[f[-> n { -> p { -> x { p[n[p][x]] } } }[m]][n]][m][x] }][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]] } } }][-> p { -> x { p[x] } }][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] } }]][-> n { -> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[p[p[p[p[p[p[p[p[p[p[x]]]]]]]]]]]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[x]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> b { b }[-> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]]][-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> n { -> p { -> x { p[n[p][x]] } } }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]]]][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> n { -> l { -> x { -> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> l { -> x { -> g { -> b { b }[-> p { p[-> x { -> y { x } }] }[l]][x][-> y { g[f[-> l { -> p { p[-> x { -> y { y } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][x][g]][-> l { -> p { p[-> x { -> y { x } }] }[-> p { p[-> x { -> y { y } }] }[l]] }[l]][y] }] } } } }][l][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }[-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][x]][-> l { -> x { -> x { -> y { -> f { f[x][y] } } }[-> x { -> y { y } }][-> x { -> y { -> f { f[x][y] } } }[x][l]] } }] } }[-> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }[-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]]][-> x { -> y { -> f { f[x][y] } } }[-> x { -> y { x } }][-> x { -> y { x } }]][-> x { f[-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { -> n { -> p { -> x { p[n[p][x]] } } }[f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n]][x] }][-> p { -> x { x } }] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]][x] }]][-> f { -> x { f[-> y { x[x][y] }] }[-> x { f[-> y { x[x][y] }] }] }[-> f { -> m { -> n { -> b { b }[-> m { -> n { -> n { n[-> x { -> x { -> y { y } } }][-> x { -> y { x } }] }[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]] } }[n][m]][-> x { f[-> m { -> n { n[-> n { -> p { p[-> x { -> y { x } }] }[n[-> p { -> x { -> y { -> f { f[x][y] } } }[-> p { p[-> x { -> y { y } }] }[p]][-> n { -> p { -> x { p[n[p][x]] } } }[-> p { p[-> x { -> y { y } }] }[p]]] }][-> x { -> y { -> f { f[x][y] } } }[-> p { -> x { x } }][-> p { -> x { x } }]]] }][m] } }[m][n]][n][x] }][m] } } }][n][-> m { -> n { n[-> m { -> n { n[-> n { -> p { -> x { p[n[p][x]] } } }][m] } }[m]][-> p { -> x { x } }] } }[-> p { -> x { p[p[x]] } }][-> p { -> x { p[p[p[p[p[x]]]]] } }]]] } }][n]]]] }]
+
+FIRST     = -> l { LEFT[RIGHT[l]] }
+IF        = -> b { b }
+LEFT      = -> p { p[-> x { -> y { x } } ] }
+RIGHT     = -> p { p[-> x { -> y { y } } ] }
+IS_EMPTY  = LEFT
+REST      = -> l { RIGHT[RIGHT[l]] }
+
+def to_integer(proc)
+  proc[-> n { n + 1 }][0]
+end
+
+def to_boolean(proc)
+  IF[proc][true][false]
+end
+
+def to_array(proc)
+  array = []
+
+  until to_boolean(IS_EMPTY[proc])
+    array.push(FIRST[proc])
+    proc = REST[proc]
+  end
+
+  array
+end
+
+def to_char(c)
+  '0123456789BFiuz'.slice(to_integer(c))
+end
+
+def to_string(s)
+  to_array(s).map { |c| to_char(c) }.join
+end
+
+answer = to_array(solution).map do |p|
+  to_string(p)
+end
+
+answer_ary = answer.to_a
+# puts answer_ary
diff --git a/bench/yarv/bm_app_mandelbrot.rb → bench/mri/bm_app_mandelbrot.rb b/bench/yarv/bm_app_mandelbrot.rb → bench/mri/bm_app_mandelbrot.rb
@@ -3,7 +3,7 @@
 def mandelbrot? z
   i = 0
   while i<100
-    i+=1
+    i += 1
     z = z * z
     return false if z.abs > 2
   end
@@ -12,8 +12,8 @@ def mandelbrot? z
 
 ary = []
 
-(0..100).each{|dx|
-  (0..100).each{|dy|
+(0..1000).each{|dx|
+  (0..1000).each{|dy|
     x = dx / 50.0
     y = dy / 50.0
     c = Complex(x, y)

diff --git a/bench/yarv/bm_app_pentomino.rb → bench/mri/bm_app_pentomino.rb b/bench/yarv/bm_app_pentomino.rb → bench/mri/bm_app_pentomino.rb
diff --git a/bench/yarv/bm_app_raise.rb → bench/mri/bm_app_raise.rb b/bench/yarv/bm_app_raise.rb → bench/mri/bm_app_raise.rb
@@ -1,6 +1,6 @@
-i=0
+i = 0
 while i<300000
-  i+=1
+  i += 1
   begin
     raise
   rescue

diff --git a/bench/mri/bm_app_strconcat.rb b/bench/mri/bm_app_strconcat.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<2_000_000
+  "#{1+1} #{1+1} #{1+1}"
+  i += 1
+end
diff --git a/bench/yarv/bm_app_tak.rb → bench/mri/bm_app_tak.rb b/bench/yarv/bm_app_tak.rb → bench/mri/bm_app_tak.rb
diff --git a/bench/yarv/bm_app_tarai.rb → bench/mri/bm_app_tarai.rb b/bench/yarv/bm_app_tarai.rb → bench/mri/bm_app_tarai.rb
diff --git a/bench/yarv/bm_app_uri.rb → bench/mri/bm_app_uri.rb b/bench/yarv/bm_app_uri.rb → bench/mri/bm_app_uri.rb
@@ -1,8 +1,8 @@
-require 'uri'
-
-100_000.times{
-  uri = URI.parse('http://www.ruby-lang.org')
-  uri.scheme
-  uri.host
-  uri.port
-}
+require 'uri'
+
+100_000.times{
+  uri = URI.parse('http://www.ruby-lang.org')
+  uri.scheme
+  uri.host
+  uri.port
+}
diff --git a/bench/mri/bm_array_shift.rb b/bench/mri/bm_array_shift.rb
@@ -0,0 +1,14 @@
+require 'benchmark'
+
+Benchmark.bm do |x|
+  [10_000,1_000_000,100_000_000].each do |n|
+    ary = Array.new(n,0)
+    GC.start
+    x.report("#{n}:shift"){ ary.shift }
+    (0..4).each do |i|
+      ary = Array.new(n,0)
+      GC.start
+      x.report("#{n}:shift(#{i})"){ ary.shift(i) }
+    end
+  end
+end
diff --git a/bench/mri/bm_hash_aref_dsym.rb b/bench/mri/bm_hash_aref_dsym.rb
@@ -0,0 +1,4 @@
+h = {}
+syms = ('a'..'z').map { |s| s.to_sym }
+syms.each { |s| h[s] = 1 }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_aref_dsym_long.rb b/bench/mri/bm_hash_aref_dsym_long.rb
@@ -0,0 +1,21 @@
+# [ruby-core:70129] [Bug #11396]
+collection_size = 200000
+sample_size = 10000
+
+values = (1..collection_size).to_a.map do |x|
+  "THIS IS A LONGER STRING THAT IS ALSO UNIQUE #{x}"
+end
+
+symbol_hash = {}
+
+values.each do |x|
+  symbol_hash[x.to_sym] = 1
+end
+
+# use the same samples each time to minimize deviations
+rng = Random.new(0)
+symbol_sample_array = values.sample(sample_size, random: rng).map(&:to_sym)
+
+3000.times do
+  symbol_sample_array.each { |x| symbol_hash[x] }
+end
diff --git a/bench/mri/bm_hash_aref_fix.rb b/bench/mri/bm_hash_aref_fix.rb
@@ -0,0 +1,4 @@
+h = {}
+nums = (1..26).to_a
+nums.each { |i| h[i] = i }
+200_000.times { nums.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_aref_flo.rb b/bench/mri/bm_hash_aref_flo.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = [*1..10000].map! {|i| i.fdiv(10)}
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_aref_miss.rb b/bench/mri/bm_hash_aref_miss.rb
@@ -0,0 +1,5 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+strs = ('A'..'Z').to_a
+200_000.times { strs.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_aref_str.rb b/bench/mri/bm_hash_aref_str.rb
@@ -0,0 +1,4 @@
+h = {}
+strs = ('a'..'z').to_a.map!(&:freeze)
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_aref_sym.rb b/bench/mri/bm_hash_aref_sym.rb
@@ -0,0 +1,9 @@
+h = {}
+syms = ('a'..'z').to_a
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_aref_sym_long.rb b/bench/mri/bm_hash_aref_sym_long.rb
@@ -0,0 +1,13 @@
+h = {}
+syms = %w[puts warn syswrite write stat bacon lettuce tomato
+some symbols in this array may already be interned  others should not be
+hash browns make good breakfast but not cooked using prime numbers
+shift for division entries delete_if keys exist?
+]
+begin
+  syms = eval("%i[#{syms.join(' ')}]")
+rescue SyntaxError # <= 1.9.3
+  syms.map!(&:to_sym)
+end
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_flatten.rb b/bench/mri/bm_hash_flatten.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+1000.times do
+  h.flatten
+end
diff --git a/bench/mri/bm_hash_ident_flo.rb b/bench/mri/bm_hash_ident_flo.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = (1..10000).to_a.map!(&:to_f)
+strs.each { |s| h[s] = s }
+50.times { strs.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_ident_num.rb b/bench/mri/bm_hash_ident_num.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+nums = (1..26).to_a
+nums.each { |n| h[n] = n }
+200_000.times { nums.each { |n| h[n] } }
diff --git a/bench/mri/bm_hash_ident_obj.rb b/bench/mri/bm_hash_ident_obj.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+objs = 26.times.map { Object.new }
+objs.each { |o| h[o] = o }
+200_000.times { objs.each { |o| h[o] } }
diff --git a/bench/mri/bm_hash_ident_str.rb b/bench/mri/bm_hash_ident_str.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+strs = ('a'..'z').to_a
+strs.each { |s| h[s] = s }
+200_000.times { strs.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_ident_sym.rb b/bench/mri/bm_hash_ident_sym.rb
@@ -0,0 +1,4 @@
+h = {}.compare_by_identity
+syms = ('a'..'z').to_a.map(&:to_sym)
+syms.each { |s| h[s] = s }
+200_000.times { syms.each { |s| h[s] } }
diff --git a/bench/mri/bm_hash_keys.rb b/bench/mri/bm_hash_keys.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.keys
+end
diff --git a/bench/mri/bm_hash_shift.rb b/bench/mri/bm_hash_shift.rb
@@ -0,0 +1,10 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+50000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/bench/mri/bm_hash_shift_u16.rb b/bench/mri/bm_hash_shift_u16.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(16384..65536).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/bench/mri/bm_hash_shift_u24.rb b/bench/mri/bm_hash_shift_u24.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xff4000..0xffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/bench/mri/bm_hash_shift_u32.rb b/bench/mri/bm_hash_shift_u32.rb
@@ -0,0 +1,10 @@
+h = {}
+
+(0xffff4000..0xffffffff).each do |i|
+  h[i] = nil
+end
+
+300000.times do
+  k, v = h.shift
+  h[k] = v
+end
diff --git a/bench/mri/bm_hash_to_proc.rb b/bench/mri/bm_hash_to_proc.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do |i|
+  [i].map(&h)
+end
diff --git a/bench/mri/bm_hash_values.rb b/bench/mri/bm_hash_values.rb
@@ -0,0 +1,9 @@
+h = {}
+
+10000.times do |i|
+  h[i] = nil
+end
+
+5000.times do
+  h.values
+end
diff --git a/bench/yarv/bm_io_file_create.rb → bench/mri/bm_io_file_create.rb b/bench/yarv/bm_io_file_create.rb → bench/mri/bm_io_file_create.rb
@@ -1,13 +1,13 @@
-#
-# Create files
-#
-
-max = 50_000
-file = './tmpfile_of_bm_io_file_create'
-
-max.times{
-  f = open(file, 'w')
-  f.close#(true)
-}
-File.unlink(file)
-
+#
+# Create files
+#
+
+max = 200_000
+file = './tmpfile_of_bm_io_file_create'
+
+max.times{
+  f = open(file, 'w')
+  f.close#(true)
+}
+File.unlink(file)
+
diff --git a/bench/yarv/bm_io_file_read.rb → bench/mri/bm_io_file_read.rb b/bench/yarv/bm_io_file_read.rb → bench/mri/bm_io_file_read.rb
@@ -1,15 +1,15 @@
-#
-# Seek and Read file.
-#
-
-require 'tempfile'
-
-max = 20_000
-str = "Hello world!  " * 1000
-f = Tempfile.new('yarv-benchmark')
-f.write str
-
-max.times{
-  f.seek 0
-  f.read
-}
+#
+# Seek and Read file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+f.write str
+
+max.times{
+  f.seek 0
+  f.read
+}
diff --git a/bench/yarv/bm_io_file_write.rb → bench/mri/bm_io_file_write.rb b/bench/yarv/bm_io_file_write.rb → bench/mri/bm_io_file_write.rb
@@ -1,14 +1,14 @@
-#
-# Seek and Write file.
-#
-
-require 'tempfile'
-
-max = 20_000
-str = "Hello world!  " * 1000
-f = Tempfile.new('yarv-benchmark')
-
-max.times{
-  f.seek 0
-  f.write str
-}
+#
+# Seek and Write file.
+#
+
+require 'tempfile'
+
+max = 200_000
+str = "Hello world!  " * 1000
+f = Tempfile.new('yarv-benchmark')
+
+max.times{
+  f.seek 0
+  f.write str
+}
diff --git a/bench/mri/bm_io_nonblock_noex.rb b/bench/mri/bm_io_nonblock_noex.rb
@@ -0,0 +1,22 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+noex = { exception: false }
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, noex)
+    r.read_nonblock(1, buf, noex)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/bench/mri/bm_io_nonblock_noex2.rb b/bench/mri/bm_io_nonblock_noex2.rb
@@ -0,0 +1,21 @@
+nr = 1_000_000
+i = 0
+msg = '.'
+buf = '.'
+begin
+  r, w = IO.pipe
+  while i < nr
+    i += 1
+    w.write_nonblock(msg, exception: false)
+    r.read_nonblock(1, buf, exception: false)
+  end
+rescue ArgumentError # old Rubies
+  while i < nr
+    i += 1
+    w.write_nonblock(msg)
+    r.read_nonblock(1, buf)
+  end
+ensure
+  r.close
+  w.close
+end
diff --git a/bench/mri/bm_io_select.rb b/bench/mri/bm_io_select.rb
@@ -0,0 +1,9 @@
+# IO.select performance
+
+w = [ IO.pipe[1] ];
+
+nr = 1000000
+nr.times {
+  IO.select nil, w
+}
+
diff --git a/bench/mri/bm_io_select2.rb b/bench/mri/bm_io_select2.rb
@@ -0,0 +1,22 @@
+# IO.select performance. worst case of single fd.
+
+ios = []
+nr = 1000000
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+((max / 2) - 10).times do
+  ios.concat IO.pipe
+end
+
+last = [ ios[-1] ]
+puts "last IO: #{last[0].inspect}"
+
+nr.times do
+  IO.select nil, last
+end
+
diff --git a/bench/mri/bm_io_select3.rb b/bench/mri/bm_io_select3.rb
@@ -0,0 +1,21 @@
+# IO.select performance. a lot of fd
+
+ios = []
+nr = 100
+if defined?(Process::RLIMIT_NOFILE)
+  max = Process.getrlimit(Process::RLIMIT_NOFILE)[0]
+else
+  max = 64
+end
+puts "max fd: #{max} (results not apparent with <= 1024 max fd)"
+
+(max - 10).times do
+  r, w = IO.pipe
+  r.close
+  ios.push w
+end
+
+nr.times do
+  IO.select nil, ios
+end
+
diff --git a/bench/mri/bm_loop_for.rb b/bench/mri/bm_loop_for.rb
@@ -0,0 +1,3 @@
+for i in 1..30_000_000
+  #
+end
diff --git a/bench/yarv/bm_loop_generator.rb → bench/mri/bm_loop_generator.rb b/bench/yarv/bm_loop_generator.rb → bench/mri/bm_loop_generator.rb
diff --git a/bench/mri/bm_loop_times.rb b/bench/mri/bm_loop_times.rb
@@ -0,0 +1 @@
+30_000_000.times{|e|}
diff --git a/bench/mri/bm_loop_whileloop.rb b/bench/mri/bm_loop_whileloop.rb
@@ -0,0 +1,4 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+end
diff --git a/bench/mri/bm_loop_whileloop2.rb b/bench/mri/bm_loop_whileloop2.rb
@@ -0,0 +1,4 @@
+i = 0
+while i< 6_000_000 # benchmark loop 2
+  i += 1
+end
diff --git a/bench/mri/bm_marshal_dump_flo.rb b/bench/mri/bm_marshal_dump_flo.rb
@@ -0,0 +1,2 @@
+bug10761 = 10000.times.map { |x| x.to_f }
+100.times { Marshal.dump(bug10761) }
diff --git a/bench/mri/bm_marshal_dump_load_geniv.rb b/bench/mri/bm_marshal_dump_load_geniv.rb
@@ -0,0 +1,10 @@
+a = ''
+a.instance_eval do
+  @a = :a
+  @b = :b
+  @c = :c
+end
+100000.times do
+  a = Marshal.load(Marshal.dump(a))
+end
+#p(a.instance_eval { @a == :a && @b == :b && @c == :c })
diff --git a/bench/mri/bm_marshal_dump_load_time.rb b/bench/mri/bm_marshal_dump_load_time.rb
@@ -0,0 +1 @@
+100000.times { Marshal.load(Marshal.dump(Time.now)) }
diff --git a/bench/mri/bm_require.rb b/bench/mri/bm_require.rb
@@ -0,0 +1,7 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+1.upto(10000) do |i|
+  require "c#{i}"
+end
+
+$:.pop
diff --git a/bench/mri/bm_require_thread.rb b/bench/mri/bm_require_thread.rb
@@ -0,0 +1,15 @@
+$:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+i=0
+t = Thread.new do
+  while true
+    i = i+1 # dummy loop
+  end
+end
+
+1.upto(100) do |i|
+  require "c#{i}"
+end
+
+$:.pop
+t.kill
diff --git a/bench/mri/bm_securerandom.rb b/bench/mri/bm_securerandom.rb
@@ -0,0 +1,5 @@
+require "securerandom"
+
+20_0000.times do
+  SecureRandom.random_number(100)
+end
diff --git a/bench/yarv/bm_so_ackermann.rb → bench/mri/bm_so_ackermann.rb b/bench/yarv/bm_so_ackermann.rb → bench/mri/bm_so_ackermann.rb
diff --git a/bench/yarv/bm_so_array.rb → bench/mri/bm_so_array.rb b/bench/yarv/bm_so_array.rb → bench/mri/bm_so_array.rb
diff --git a/bench/yarv/bm_so_binary_trees.rb → bench/mri/bm_so_binary_trees.rb b/bench/yarv/bm_so_binary_trees.rb → bench/mri/bm_so_binary_trees.rb
@@ -1,57 +1,62 @@
-# The Computer Language Shootout Benchmarks
-# http://shootout.alioth.debian.org
-#
-# contributed by Jesse Millikan
-
-# disable output
-def STDOUT.write_ *args
-end
-
-def item_check(tree)
- if tree[0] == nil
-  tree[1]
- else
-  tree[1] + item_check(tree[0]) - item_check(tree[2])
- end
-end
-
-def bottom_up_tree(item, depth)
- if depth > 0
-  item_item = 2 * item
-  depth -= 1
-  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
- else
-  [nil, item, nil]
- end
-end
-
-max_depth = 12 # 16 # ARGV[0].to_i
-min_depth = 4
-
-max_depth = min_depth + 2 if min_depth + 2 > max_depth
-
-stretch_depth = max_depth + 1
-stretch_tree = bottom_up_tree(0, stretch_depth)
-
-puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
-stretch_tree = nil
-
-long_lived_tree = bottom_up_tree(0, max_depth)
-
-min_depth.step(max_depth + 1, 2) do |depth|
- iterations = 2**(max_depth - depth + min_depth)
-
- check = 0
-
- for i in 1..iterations
-  temp_tree = bottom_up_tree(i, depth)
-  check += item_check(temp_tree)
-
-  temp_tree = bottom_up_tree(-i, depth)
-  check += item_check(temp_tree)
- end
-
- puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
-end
-
-puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+# The Computer Language Shootout Benchmarks
+# http://shootout.alioth.debian.org
+#
+# contributed by Jesse Millikan
+
+# disable output
+alias puts_orig puts
+def puts str
+  # disable puts
+end
+
+def item_check(tree)
+ if tree[0] == nil
+  tree[1]
+ else
+  tree[1] + item_check(tree[0]) - item_check(tree[2])
+ end
+end
+
+def bottom_up_tree(item, depth)
+ if depth > 0
+  item_item = 2 * item
+  depth -= 1
+  [bottom_up_tree(item_item - 1, depth), item, bottom_up_tree(item_item, depth)]
+ else
+  [nil, item, nil]
+ end
+end
+
+max_depth = 16 # ARGV[0].to_i
+min_depth = 4
+
+max_depth = min_depth + 2 if min_depth + 2 > max_depth
+
+stretch_depth = max_depth + 1
+stretch_tree = bottom_up_tree(0, stretch_depth)
+
+puts "stretch tree of depth #{stretch_depth}\t check: #{item_check(stretch_tree)}"
+stretch_tree = nil
+
+long_lived_tree = bottom_up_tree(0, max_depth)
+
+min_depth.step(max_depth + 1, 2) do |depth|
+ iterations = 2**(max_depth - depth + min_depth)
+
+ check = 0
+
+ for i in 1..iterations
+  temp_tree = bottom_up_tree(i, depth)
+  check += item_check(temp_tree)
+
+  temp_tree = bottom_up_tree(-i, depth)
+  check += item_check(temp_tree)
+ end
+
+ puts "#{iterations * 2}\t trees of depth #{depth}\t check: #{check}"
+end
+
+puts "long lived tree of depth #{max_depth}\t check: #{item_check(long_lived_tree)}"
+
+undef puts
+alias puts puts_orig
diff --git a/bench/yarv/bm_so_concatenate.rb → bench/mri/bm_so_concatenate.rb b/bench/yarv/bm_so_concatenate.rb → bench/mri/bm_so_concatenate.rb
@@ -5,11 +5,11 @@
 # based on code from Aristarkh A Zagorodnikov and Dat Nguyen
 
 STUFF = "hello\n"
-i=0
+i = 0
 while i<10
-  i+=1
+  i += 1
   hello = ''
-  400000.times do |e|
+  4_000_000.times do |e|
     hello << STUFF
   end
 end

diff --git a/bench/yarv/bm_so_count_words.rb → bench/mri/bm_so_count_words.rb b/bench/yarv/bm_so_count_words.rb → bench/mri/bm_so_count_words.rb
diff --git a/bench/yarv/bm_so_exception.rb → bench/mri/bm_so_exception.rb b/bench/yarv/bm_so_exception.rb → bench/mri/bm_so_exception.rb
@@ -56,6 +56,6 @@ def blowup(num)
 i = 1
 max = NUM+1
 while i < max
-  i+=1
+  i += 1
   some_function(i+1)
 end
diff --git a/bench/yarv/bm_so_fannkuch.rb → bench/mri/bm_so_fannkuch.rb b/bench/yarv/bm_so_fannkuch.rb → bench/mri/bm_so_fannkuch.rb
@@ -1,45 +1,45 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-# Modified by Ryan Williams
-
-def fannkuch(n)
-   maxFlips, m, r, check = 0, n-1, n, 0
-   count = (1..n).to_a
-   perm = (1..n).to_a
-
-   while true
-      if check < 30
-         puts "#{perm}"
-         check += 1
-      end
-
-      while r != 1
-         count[r-1] = r
-         r -= 1
-      end
-
-      if perm[0] != 1 and perm[m] != n
-         perml = perm.clone #.dup
-         flips = 0
-         while (k = perml.first ) != 1
-            perml = perml.slice!(0, k).reverse + perml
-            flips += 1
-         end
-         maxFlips = flips if flips > maxFlips
-      end
-      while true
-         if r==n then return maxFlips end
-         perm.insert r,perm.shift
-         break if (count[r] -= 1) > 0
-         r += 1
-      end
-   end
-end
-
-def puts *args
-end
-
-N = 10 # (ARGV[0] || 1).to_i
-puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
-
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+# Modified by Ryan Williams
+
+def fannkuch(n)
+   maxFlips, m, r, check = 0, n-1, n, 0
+   count = (1..n).to_a
+   perm = (1..n).to_a
+
+   while true
+      if check < 30
+         puts "#{perm}"
+         check += 1
+      end
+
+      while r != 1
+         count[r-1] = r
+         r -= 1
+      end
+
+      if perm[0] != 1 and perm[m] != n
+         perml = perm.clone #.dup
+         flips = 0
+         while (k = perml.first ) != 1
+            perml = perml.slice!(0, k).reverse + perml
+            flips += 1
+         end
+         maxFlips = flips if flips > maxFlips
+      end
+      while true
+         if r==n then return maxFlips end
+         perm.insert r,perm.shift
+         break if (count[r] -= 1) > 0
+         r += 1
+      end
+   end
+end
+
+def puts *args
+end
+
+N = 9 # (ARGV[0] || 1).to_i
+puts "Pfannkuchen(#{N}) = #{fannkuch(N)}"
+
diff --git a/bench/yarv/bm_so_fasta.rb → bench/mri/bm_so_fasta.rb b/bench/yarv/bm_so_fasta.rb → bench/mri/bm_so_fasta.rb
@@ -1,81 +1,81 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-$last = 42.0
-def gen_random (max,im=139968,ia=3877,ic=29573)
-    (max * ($last = ($last * ia + ic) % im)) / im
-end
-
-alu =
-   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
-   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
-   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
-   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
-   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
-   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
-   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
-
-iub = [
-    ["a", 0.27],
-    ["c", 0.12],
-    ["g", 0.12],
-    ["t", 0.27],
-
-    ["B", 0.02],
-    ["D", 0.02],
-    ["H", 0.02],
-    ["K", 0.02],
-    ["M", 0.02],
-    ["N", 0.02],
-    ["R", 0.02],
-    ["S", 0.02],
-    ["V", 0.02],
-    ["W", 0.02],
-    ["Y", 0.02],
-]
-homosapiens = [
-    ["a", 0.3029549426680],
-    ["c", 0.1979883004921],
-    ["g", 0.1975473066391],
-    ["t", 0.3015094502008],
-]
-
-def make_repeat_fasta(id, desc, src, n)
-    puts ">#{id} #{desc}"
-    v = nil
-    width = 60
-    l = src.length
-    s = src * ((n / l) + 1)
-    s.slice!(n, l)
-    puts(s.scan(/.{1,#{width}}/).join("\n"))
-end
-
-def make_random_fasta(id, desc, table, n)
-    puts ">#{id} #{desc}"
-    rand, v = nil,nil
-    width = 60
-    chunk = 1 * width
-    prob = 0.0
-    table.each{|v| v[1]= (prob += v[1])}
-    for i in 1..(n/width)
-        puts((1..width).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-    if n%width != 0
-        puts((1..(n%width)).collect{
-            rand = gen_random(1.0)
-            table.find{|v| v[1]>rand}[0]
-        }.join)
-    end
-end
-
-
-n = (ARGV[0] or 250_000).to_i
-
-make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
-make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
-make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
-
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+$last = 42.0
+def gen_random (max,im=139968,ia=3877,ic=29573)
+    (max * ($last = ($last * ia + ic) % im)) / im
+end
+
+alu =
+   "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+   "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+   "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+   "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+   "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+   "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+   "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+iub = [
+    ["a", 0.27],
+    ["c", 0.12],
+    ["g", 0.12],
+    ["t", 0.27],
+
+    ["B", 0.02],
+    ["D", 0.02],
+    ["H", 0.02],
+    ["K", 0.02],
+    ["M", 0.02],
+    ["N", 0.02],
+    ["R", 0.02],
+    ["S", 0.02],
+    ["V", 0.02],
+    ["W", 0.02],
+    ["Y", 0.02],
+]
+homosapiens = [
+    ["a", 0.3029549426680],
+    ["c", 0.1979883004921],
+    ["g", 0.1975473066391],
+    ["t", 0.3015094502008],
+]
+
+def make_repeat_fasta(id, desc, src, n)
+    puts ">#{id} #{desc}"
+    v = nil
+    width = 60
+    l = src.length
+    s = src * ((n / l) + 1)
+    s.slice!(n, l)
+    puts(s.scan(/.{1,#{width}}/).join("\n"))
+end
+
+def make_random_fasta(id, desc, table, n)
+    puts ">#{id} #{desc}"
+    rand, v = nil,nil
+    width = 60
+    chunk = 1 * width
+    prob = 0.0
+    table.each{|v| v[1]= (prob += v[1])}
+    for i in 1..(n/width)
+        puts((1..width).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+    if n%width != 0
+        puts((1..(n%width)).collect{
+            rand = gen_random(1.0)
+            table.find{|v| v[1]>rand}[0]
+        }.join)
+    end
+end
+
+
+n = (ARGV[0] or 250_000).to_i
+
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+
diff --git a/bench/yarv/bm_so_k_nucleotide.rb → bench/mri/bm_so_k_nucleotide.rb b/bench/yarv/bm_so_k_nucleotide.rb → bench/mri/bm_so_k_nucleotide.rb
@@ -1,48 +1,48 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
-    n, table = seq.length - length + 1, Hash.new(0)
-    f, i = nil, nil
-    (0 ... length).each do |f|
-        (f ... n).step(length) do |i|
-            table[seq[i,length]] += 1
-        end
-    end
-    [n,table]
-
-end
-
-def sort_by_freq( seq,length )
-    n,table = frecuency( seq,length )
-    a, b, v = nil, nil, nil
-    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
-        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
-    end
-    puts
-end
-
-def find_seq( seq,s )
-    n,table = frecuency( seq,s.length )
-    puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
-    seq << line.chomp
-    line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# contributed by jose fco. gonzalez
+# modified by Sokolov Yura
+
+seq = String.new
+
+def frecuency( seq,length )
+    n, table = seq.length - length + 1, Hash.new(0)
+    f, i = nil, nil
+    (0 ... length).each do |f|
+        (f ... n).step(length) do |i|
+            table[seq[i,length]] += 1
+        end
+    end
+    [n,table]
+
+end
+
+def sort_by_freq( seq,length )
+    n,table = frecuency( seq,length )
+    a, b, v = nil, nil, nil
+    table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+        puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+    end
+    puts
+end
+
+def find_seq( seq,s )
+    n,table = frecuency( seq,s.length )
+    puts "#{table[s].to_s}\t#{s.upcase}"
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+line = input.gets while line !~ /^>THREE/
+line = input.gets
+
+while (line !~ /^>/) & line do
+    seq << line.chomp
+    line = input.gets
+end
+
+[1,2].each {|i| sort_by_freq( seq,i ) }
+
+%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+
diff --git a/bench/yarv/bm_so_lists.rb → bench/mri/bm_so_lists.rb b/bench/yarv/bm_so_lists.rb → bench/mri/bm_so_lists.rb
@@ -1,6 +1,6 @@
 #from http://www.bagley.org/~doug/shootout/bench/lists/lists.ruby
 
-NUM = 100
+NUM = 300
 SIZE = 10000
 
 def test_lists()
@@ -40,7 +40,7 @@ def test_lists()
 
 i = 0
 while i<NUM
-  i+=1
+  i += 1
   result = test_lists()
 end
 

diff --git a/bench/yarv/bm_so_mandelbrot.rb → bench/mri/bm_so_mandelbrot.rb b/bench/yarv/bm_so_mandelbrot.rb → bench/mri/bm_so_mandelbrot.rb
@@ -1,57 +1,57 @@
-#  The Computer Language Benchmarks Game
-#  http://shootout.alioth.debian.org/
-#
-#  contributed by Karl von Laudermann
-#  modified by Jeremy Echols
-
-size = 600 # ARGV[0].to_i
-
-puts "P4\n#{size} #{size}"
-
-ITER = 49                           # Iterations - 1 for easy for..in looping
-LIMIT_SQUARED = 4.0                 # Presquared limit
-
-byte_acc = 0
-bit_num = 0
-
-count_size = size - 1               # Precomputed size for easy for..in looping
-
-# For..in loops are faster than .upto, .downto, .times, etc.
-for y in 0..count_size
-  for x in 0..count_size
-    zr = 0.0
-    zi = 0.0
-    cr = (2.0*x/size)-1.5
-    ci = (2.0*y/size)-1.0
-    escape = false
-
-    # To make use of the for..in code, we use a dummy variable,
-    # like one would in C
-    for dummy in 0..ITER
-      tr = zr*zr - zi*zi + cr
-      ti = 2*zr*zi + ci
-      zr, zi = tr, ti
-
-      if (zr*zr+zi*zi) > LIMIT_SQUARED
-        escape = true
-        break
-      end
-    end
-
-    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
-    bit_num += 1
-
-    # Code is very similar for these cases, but using separate blocks
-    # ensures we skip the shifting when it's unnecessary, which is most cases.
-    if (bit_num == 8)
-      print byte_acc.chr
-      byte_acc = 0
-      bit_num = 0
-    elsif (x == count_size)
-      byte_acc <<= (8 - bit_num)
-      print byte_acc.chr
-      byte_acc = 0
-      bit_num = 0
-    end
-  end
-end
+#  The Computer Language Benchmarks Game
+#  http://shootout.alioth.debian.org/
+#
+#  contributed by Karl von Laudermann
+#  modified by Jeremy Echols
+
+size = 600 # ARGV[0].to_i
+
+puts "P4\n#{size} #{size}"
+
+ITER = 49                           # Iterations - 1 for easy for..in looping
+LIMIT_SQUARED = 4.0                 # Presquared limit
+
+byte_acc = 0
+bit_num = 0
+
+count_size = size - 1               # Precomputed size for easy for..in looping
+
+# For..in loops are faster than .upto, .downto, .times, etc.
+for y in 0..count_size
+  for x in 0..count_size
+    zr = 0.0
+    zi = 0.0
+    cr = (2.0*x/size)-1.5
+    ci = (2.0*y/size)-1.0
+    escape = false
+
+    # To make use of the for..in code, we use a dummy variable,
+    # like one would in C
+    for dummy in 0..ITER
+      tr = zr*zr - zi*zi + cr
+      ti = 2*zr*zi + ci
+      zr, zi = tr, ti
+
+      if (zr*zr+zi*zi) > LIMIT_SQUARED
+        escape = true
+        break
+      end
+    end
+
+    byte_acc = (byte_acc << 1) | (escape ? 0b0 : 0b1)
+    bit_num += 1
+
+    # Code is very similar for these cases, but using separate blocks
+    # ensures we skip the shifting when it's unnecessary, which is most cases.
+    if (bit_num == 8)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    elsif (x == count_size)
+      byte_acc <<= (8 - bit_num)
+      print byte_acc.chr
+      byte_acc = 0
+      bit_num = 0
+    end
+  end
+end
diff --git a/bench/yarv/bm_so_matrix.rb → bench/mri/bm_so_matrix.rb b/bench/yarv/bm_so_matrix.rb → bench/mri/bm_so_matrix.rb
@@ -5,7 +5,7 @@
 
 n = 60 #Integer(ARGV.shift || 1)
 
-size = 30
+size = 40
 
 def mkmatrix(rows, cols)
     count = 1

diff --git a/bench/yarv/bm_so_meteor_contest.rb → bench/mri/bm_so_meteor_contest.rb b/bench/yarv/bm_so_meteor_contest.rb → bench/mri/bm_so_meteor_contest.rb
diff --git a/bench/yarv/bm_so_nbody.rb → bench/mri/bm_so_nbody.rb b/bench/yarv/bm_so_nbody.rb → bench/mri/bm_so_nbody.rb
@@ -1,148 +1,148 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# Optimized for Ruby by Jesse Millikan
-# From version ported by Michael Neumann from the C gcc version,
-# which was written by Christoph Bauer.
-
-SOLAR_MASS = 4 * Math::PI**2
-DAYS_PER_YEAR = 365.24
-
-def _puts *args
-end
-
-class Planet
- attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
-
- def initialize(x, y, z, vx, vy, vz, mass)
-  @x, @y, @z = x, y, z
-  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
-  @mass = mass * SOLAR_MASS
- end
-
- def move_from_i(bodies, nbodies, dt, i)
-  while i < nbodies
-   b2 = bodies[i]
-   dx = @x - b2.x
-   dy = @y - b2.y
-   dz = @z - b2.z
-
-   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-   mag = dt / (distance * distance * distance)
-   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
-
-   @vx -= dx * b2_mass_mag
-   @vy -= dy * b2_mass_mag
-   @vz -= dz * b2_mass_mag
-   b2.vx += dx * b_mass_mag
-   b2.vy += dy * b_mass_mag
-   b2.vz += dz * b_mass_mag
-   i += 1
-  end
-
-  @x += dt * @vx
-  @y += dt * @vy
-  @z += dt * @vz
- end
-end
-
-def energy(bodies)
-  e = 0.0
-  nbodies = bodies.size
-
-  for i in 0 ... nbodies
-    b = bodies[i]
-    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
-    for j in (i + 1) ... nbodies
-      b2 = bodies[j]
-      dx = b.x - b2.x
-      dy = b.y - b2.y
-      dz = b.z - b2.z
-      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
-      e -= (b.mass * b2.mass) / distance
-    end
-  end
-  e
-end
-
-def offset_momentum(bodies)
-  px, py, pz = 0.0, 0.0, 0.0
-
-  for b in bodies
-    m = b.mass
-    px += b.vx * m
-    py += b.vy * m
-    pz += b.vz * m
-  end
-
-  b = bodies[0]
-  b.vx = - px / SOLAR_MASS
-  b.vy = - py / SOLAR_MASS
-  b.vz = - pz / SOLAR_MASS
-end
-
-BODIES = [
-  # sun
-  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
-
-  # jupiter
-  Planet.new(
-    4.84143144246472090e+00,
-    -1.16032004402742839e+00,
-    -1.03622044471123109e-01,
-    1.66007664274403694e-03,
-    7.69901118419740425e-03,
-    -6.90460016972063023e-05,
-    9.54791938424326609e-04),
-
-  # saturn
-  Planet.new(
-    8.34336671824457987e+00,
-    4.12479856412430479e+00,
-    -4.03523417114321381e-01,
-    -2.76742510726862411e-03,
-    4.99852801234917238e-03,
-    2.30417297573763929e-05,
-    2.85885980666130812e-04),
-
-  # uranus
-  Planet.new(
-    1.28943695621391310e+01,
-    -1.51111514016986312e+01,
-    -2.23307578892655734e-01,
-    2.96460137564761618e-03,
-    2.37847173959480950e-03,
-    -2.96589568540237556e-05,
-    4.36624404335156298e-05),
-
-  # neptune
-  Planet.new(
-    1.53796971148509165e+01,
-    -2.59193146099879641e+01,
-    1.79258772950371181e-01,
-    2.68067772490389322e-03,
-    1.62824170038242295e-03,
-    -9.51592254519715870e-05,
-    5.15138902046611451e-05)
-]
-
-init = 200_000 # ARGV[0]
-n = Integer(init)
-
-offset_momentum(BODIES)
-
-puts "%.9f" % energy(BODIES)
-
-nbodies = BODIES.size
-dt = 0.01
-
-n.times do
-  i = 0
-  while i < nbodies
-    b = BODIES[i]
-    b.move_from_i(BODIES, nbodies, dt, i + 1)
-    i += 1
-  end
-end
-
-puts "%.9f" % energy(BODIES)
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org
+#
+# Optimized for Ruby by Jesse Millikan
+# From version ported by Michael Neumann from the C gcc version,
+# which was written by Christoph Bauer.
+
+SOLAR_MASS = 4 * Math::PI**2
+DAYS_PER_YEAR = 365.24
+
+def _puts *args
+end
+
+class Planet
+ attr_accessor :x, :y, :z, :vx, :vy, :vz, :mass
+
+ def initialize(x, y, z, vx, vy, vz, mass)
+  @x, @y, @z = x, y, z
+  @vx, @vy, @vz = vx * DAYS_PER_YEAR, vy * DAYS_PER_YEAR, vz * DAYS_PER_YEAR
+  @mass = mass * SOLAR_MASS
+ end
+
+ def move_from_i(bodies, nbodies, dt, i)
+  while i < nbodies
+   b2 = bodies[i]
+   dx = @x - b2.x
+   dy = @y - b2.y
+   dz = @z - b2.z
+
+   distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+   mag = dt / (distance * distance * distance)
+   b_mass_mag, b2_mass_mag = @mass * mag, b2.mass * mag
+
+   @vx -= dx * b2_mass_mag
+   @vy -= dy * b2_mass_mag
+   @vz -= dz * b2_mass_mag
+   b2.vx += dx * b_mass_mag
+   b2.vy += dy * b_mass_mag
+   b2.vz += dz * b_mass_mag
+   i += 1
+  end
+
+  @x += dt * @vx
+  @y += dt * @vy
+  @z += dt * @vz
+ end
+end
+
+def energy(bodies)
+  e = 0.0
+  nbodies = bodies.size
+
+  for i in 0 ... nbodies
+    b = bodies[i]
+    e += 0.5 * b.mass * (b.vx * b.vx + b.vy * b.vy + b.vz * b.vz)
+    for j in (i + 1) ... nbodies
+      b2 = bodies[j]
+      dx = b.x - b2.x
+      dy = b.y - b2.y
+      dz = b.z - b2.z
+      distance = Math.sqrt(dx * dx + dy * dy + dz * dz)
+      e -= (b.mass * b2.mass) / distance
+    end
+  end
+  e
+end
+
+def offset_momentum(bodies)
+  px, py, pz = 0.0, 0.0, 0.0
+
+  for b in bodies
+    m = b.mass
+    px += b.vx * m
+    py += b.vy * m
+    pz += b.vz * m
+  end
+
+  b = bodies[0]
+  b.vx = - px / SOLAR_MASS
+  b.vy = - py / SOLAR_MASS
+  b.vz = - pz / SOLAR_MASS
+end
+
+BODIES = [
+  # sun
+  Planet.new(0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 1.0),
+
+  # jupiter
+  Planet.new(
+    4.84143144246472090e+00,
+    -1.16032004402742839e+00,
+    -1.03622044471123109e-01,
+    1.66007664274403694e-03,
+    7.69901118419740425e-03,
+    -6.90460016972063023e-05,
+    9.54791938424326609e-04),
+
+  # saturn
+  Planet.new(
+    8.34336671824457987e+00,
+    4.12479856412430479e+00,
+    -4.03523417114321381e-01,
+    -2.76742510726862411e-03,
+    4.99852801234917238e-03,
+    2.30417297573763929e-05,
+    2.85885980666130812e-04),
+
+  # uranus
+  Planet.new(
+    1.28943695621391310e+01,
+    -1.51111514016986312e+01,
+    -2.23307578892655734e-01,
+    2.96460137564761618e-03,
+    2.37847173959480950e-03,
+    -2.96589568540237556e-05,
+    4.36624404335156298e-05),
+
+  # neptune
+  Planet.new(
+    1.53796971148509165e+01,
+    -2.59193146099879641e+01,
+    1.79258772950371181e-01,
+    2.68067772490389322e-03,
+    1.62824170038242295e-03,
+    -9.51592254519715870e-05,
+    5.15138902046611451e-05)
+]
+
+init = 200_000 # ARGV[0]
+n = Integer(init)
+
+offset_momentum(BODIES)
+
+puts "%.9f" % energy(BODIES)
+
+nbodies = BODIES.size
+dt = 0.01
+
+n.times do
+  i = 0
+  while i < nbodies
+    b = BODIES[i]
+    b.move_from_i(BODIES, nbodies, dt, i + 1)
+    i += 1
+  end
+end
+
+puts "%.9f" % energy(BODIES)
diff --git a/bench/yarv/bm_so_nested_loop.rb → bench/mri/bm_so_nested_loop.rb b/bench/yarv/bm_so_nested_loop.rb → bench/mri/bm_so_nested_loop.rb
diff --git a/bench/yarv/bm_so_nsieve.rb → bench/mri/bm_so_nsieve.rb b/bench/yarv/bm_so_nsieve.rb → bench/mri/bm_so_nsieve.rb
@@ -1,35 +1,35 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Glenn Parker, March 2005
-# modified by Evan Phoenix, Sept 2006
-
-def sieve(m)
-  flags = Flags.dup[0,m]
-  count = 0
-  pmax = m - 1
-  p = 2
-  while p <= pmax
-    unless flags[p].zero?
-      count += 1
-      mult = p
-      while mult <= pmax
-        flags[mult] = 0
-        mult += p
-      end
-    end
-    p += 1
-  end
-  count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
-
-n.downto(n-2) do |exponent|
-  break if exponent < 0
-  m = (1 << exponent) * 10_000
-  # m = (2 ** exponent) * 10_000
-  count = sieve(m)
-  printf "Primes up to %8d %8d\n", m, count
-end
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Glenn Parker, March 2005
+# modified by Evan Phoenix, Sept 2006
+
+def sieve(m)
+  flags = Flags.dup[0,m]
+  count = 0
+  pmax = m - 1
+  p = 2
+  while p <= pmax
+    unless flags[p].zero?
+      count += 1
+      mult = p
+      while mult <= pmax
+        flags[mult] = 0
+        mult += p
+      end
+    end
+    p += 1
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+Flags = ("\x1" * ( 2 ** n * 10_000)).unpack("c*")
+
+n.downto(n-2) do |exponent|
+  break if exponent < 0
+  m = (1 << exponent) * 10_000
+  # m = (2 ** exponent) * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
diff --git a/bench/yarv/bm_so_nsieve_bits.rb → bench/mri/bm_so_nsieve_bits.rb b/bench/yarv/bm_so_nsieve_bits.rb → bench/mri/bm_so_nsieve_bits.rb
@@ -1,42 +1,43 @@
-#!/usr/bin/ruby
-#
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# nsieve-bits in Ruby
-# Contributed by Glenn Parker, March 2005
-
-CharExponent = 3
-BitsPerChar = 1 << CharExponent
-LowMask = BitsPerChar - 1
-
-def sieve(m)
-  items = "\xFF" * ((m / BitsPerChar) + 1)
-  masks = ""
-  BitsPerChar.times do |b|
-    masks << (1 << b).chr
-  end
-
-  count = 0
-  pmax = m - 1
-  2.step(pmax, 1) do |p|
-    if items[p >> CharExponent][p & LowMask] == 1
-      count += 1
-      p.step(pmax, p) do |mult|
-	a = mult >> CharExponent
-	b = mult & LowMask
-	items[a] -= masks[b] if items[a][b] != 0
-      end
-    end
-  end
-  count
-end
-
-n = 9 # (ARGV[0] || 2).to_i
-n.step(n - 2, -1) do |exponent|
-  break if exponent < 0
-  m = 2 ** exponent * 10_000
-  count = sieve(m)
-  printf "Primes up to %8d %8d\n", m, count
-end
-
+#!/usr/bin/ruby
+#coding: us-ascii
+#
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# nsieve-bits in Ruby
+# Contributed by Glenn Parker, March 2005
+
+CharExponent = 3
+BitsPerChar = 1 << CharExponent
+LowMask = BitsPerChar - 1
+
+def sieve(m)
+  items = "\xFF" * ((m / BitsPerChar) + 1)
+  masks = ""
+  BitsPerChar.times do |b|
+    masks << (1 << b).chr
+  end
+
+  count = 0
+  pmax = m - 1
+  2.step(pmax, 1) do |p|
+    if items[p >> CharExponent][p & LowMask] == 1
+      count += 1
+      p.step(pmax, p) do |mult|
+	a = mult >> CharExponent
+	b = mult & LowMask
+	items[a] -= masks[b] if items[a][b] != 0
+      end
+    end
+  end
+  count
+end
+
+n = 9 # (ARGV[0] || 2).to_i
+n.step(n - 2, -1) do |exponent|
+  break if exponent < 0
+  m = 2 ** exponent * 10_000
+  count = sieve(m)
+  printf "Primes up to %8d %8d\n", m, count
+end
+
diff --git a/bench/yarv/bm_so_object.rb → bench/mri/bm_so_object.rb b/bench/yarv/bm_so_object.rb → bench/mri/bm_so_object.rb
diff --git a/bench/yarv/bm_so_partial_sums.rb → bench/mri/bm_so_partial_sums.rb b/bench/yarv/bm_so_partial_sums.rb → bench/mri/bm_so_partial_sums.rb
@@ -1,31 +1,31 @@
-n = 2_500_000 # (ARGV.shift || 1).to_i
-
-alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
-
-1.upto(n) do |d|
-  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
-
-  s0 += (2.0 / 3.0) ** (d - 1.0)
-  s1 += 1.0 / Math.sqrt(d)
-  s2 += 1.0 / (d * (d + 1.0))
-  s3 += 1.0 / (d3 * ds * ds)
-  s4 += 1.0 / (d3 * dc * dc)
-  s5 += 1.0 / d
-  s6 += 1.0 / d2
-  s7 += alt / d
-  s8 += alt / (2.0 * d - 1.0)
-
-  alt = -alt
-end
-
-if false
-  printf("%.9f\t(2/3)^k\n", s0)
-  printf("%.9f\tk^-0.5\n", s1)
-  printf("%.9f\t1/k(k+1)\n", s2)
-  printf("%.9f\tFlint Hills\n", s3)
-  printf("%.9f\tCookson Hills\n", s4)
-  printf("%.9f\tHarmonic\n", s5)
-  printf("%.9f\tRiemann Zeta\n", s6)
-  printf("%.9f\tAlternating Harmonic\n", s7)
-  printf("%.9f\tGregory\n", s8)
-end
+n = 2_500_000 # (ARGV.shift || 1).to_i
+
+alt = 1.0 ; s0 = s1 = s2 = s3 = s4 = s5 = s6 = s7 = s8 = 0.0
+
+1.upto(n) do |d|
+  d = d.to_f ; d2 = d * d ; d3 = d2 * d ; ds = Math.sin(d) ; dc = Math.cos(d)
+
+  s0 += (2.0 / 3.0) ** (d - 1.0)
+  s1 += 1.0 / Math.sqrt(d)
+  s2 += 1.0 / (d * (d + 1.0))
+  s3 += 1.0 / (d3 * ds * ds)
+  s4 += 1.0 / (d3 * dc * dc)
+  s5 += 1.0 / d
+  s6 += 1.0 / d2
+  s7 += alt / d
+  s8 += alt / (2.0 * d - 1.0)
+
+  alt = -alt
+end
+
+if false
+  printf("%.9f\t(2/3)^k\n", s0)
+  printf("%.9f\tk^-0.5\n", s1)
+  printf("%.9f\t1/k(k+1)\n", s2)
+  printf("%.9f\tFlint Hills\n", s3)
+  printf("%.9f\tCookson Hills\n", s4)
+  printf("%.9f\tHarmonic\n", s5)
+  printf("%.9f\tRiemann Zeta\n", s6)
+  printf("%.9f\tAlternating Harmonic\n", s7)
+  printf("%.9f\tGregory\n", s8)
+end
diff --git a/bench/yarv/bm_so_pidigits.rb → bench/mri/bm_so_pidigits.rb b/bench/yarv/bm_so_pidigits.rb → bench/mri/bm_so_pidigits.rb
@@ -1,92 +1,92 @@
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# contributed by Gabriele Renzi
-
-class PiDigitSpigot
-
-    def initialize()
-        @z = Transformation.new 1,0,0,1
-        @x = Transformation.new 0,0,0,0
-        @inverse = Transformation.new 0,0,0,0
-    end
-
-    def next!
-        @y = @z.extract(3)
-        if safe? @y
-            @z = produce(@y)
-            @y
-        else
-            @z = consume @x.next!()
-            next!()
-        end
-    end
-
-    def safe?(digit)
-        digit == @z.extract(4)
-    end
-
-    def produce(i)
-        @inverse.qrst(10,-10*i,0,1).compose(@z)
-    end
-
-    def consume(a)
-        @z.compose(a)
-    end
-end
-
-
-class Transformation
-    attr_reader :q, :r, :s, :t
-    def initialize (q, r, s, t)
-        @q,@r,@s,@t,@k = q,r,s,t,0
-    end
-
-    def next!()
-        @q = @k = @k + 1
-        @r = 4 * @k + 2
-        @s = 0
-        @t = 2 * @k + 1
-        self
-    end
-
-    def extract(j)
-        (@q * j + @r) / (@s * j + @t)
-    end
-
-    def compose(a)
-        self.class.new( @q * a.q,
-                        @q * a.r + r * a.t,
-                        @s * a.q + t * a.s,
-                        @s * a.r + t * a.t
-                    )
-    end
-
-    def qrst *args
-        initialize *args
-        self
-    end
-
-
-end
-
-
-WIDTH = 10
-n = 2_500 # Integer(ARGV[0])
-j = 0
-
-digits = PiDigitSpigot.new
-
-while n > 0
-    if n >= WIDTH
-        WIDTH.times {print digits.next!}
-        j += WIDTH
-    else
-        n.times {print digits.next!}
-        (WIDTH-n).times {print " "}
-        j += n
-    end
-    puts "\t:"+j.to_s
-    n -= WIDTH
-end
-
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# contributed by Gabriele Renzi
+
+class PiDigitSpigot
+
+    def initialize()
+        @z = Transformation.new 1,0,0,1
+        @x = Transformation.new 0,0,0,0
+        @inverse = Transformation.new 0,0,0,0
+    end
+
+    def next!
+        @y = @z.extract(3)
+        if safe? @y
+            @z = produce(@y)
+            @y
+        else
+            @z = consume @x.next!()
+            next!()
+        end
+    end
+
+    def safe?(digit)
+        digit == @z.extract(4)
+    end
+
+    def produce(i)
+        @inverse.qrst(10,-10*i,0,1).compose(@z)
+    end
+
+    def consume(a)
+        @z.compose(a)
+    end
+end
+
+
+class Transformation
+    attr_reader :q, :r, :s, :t
+    def initialize (q, r, s, t)
+        @q,@r,@s,@t,@k = q,r,s,t,0
+    end
+
+    def next!()
+        @q = @k = @k + 1
+        @r = 4 * @k + 2
+        @s = 0
+        @t = 2 * @k + 1
+        self
+    end
+
+    def extract(j)
+        (@q * j + @r) / (@s * j + @t)
+    end
+
+    def compose(a)
+        self.class.new( @q * a.q,
+                        @q * a.r + r * a.t,
+                        @s * a.q + t * a.s,
+                        @s * a.r + t * a.t
+                    )
+    end
+
+    def qrst *args
+        initialize *args
+        self
+    end
+
+
+end
+
+
+WIDTH = 10
+n = 2_500 # Integer(ARGV[0])
+j = 0
+
+digits = PiDigitSpigot.new
+
+while n > 0
+    if n >= WIDTH
+        WIDTH.times {print digits.next!}
+        j += WIDTH
+    else
+        n.times {print digits.next!}
+        (WIDTH-n).times {print " "}
+        j += n
+    end
+    puts "\t:"+j.to_s
+    n -= WIDTH
+end
+
diff --git a/bench/yarv/bm_so_random.rb → bench/mri/bm_so_random.rb b/bench/yarv/bm_so_random.rb → bench/mri/bm_so_random.rb
@@ -10,11 +10,11 @@ def gen_random(max)
   (max * ($last = ($last * IA + IC) % IM)) / IM
 end
 
-N = 1000000
+N = 3_000_000
 
-i=0
+i = 0
 while i<N
-  i+=1
+  i +=1
   gen_random(100.0)
 end
 # "%.9f" % gen_random(100.0)
diff --git a/bench/yarv/bm_so_reverse_complement.rb → bench/mri/bm_so_reverse_complement.rb b/bench/yarv/bm_so_reverse_complement.rb → bench/mri/bm_so_reverse_complement.rb
@@ -1,30 +1,30 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
-  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
-  stringlen=seq.length
-  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
-  if $_ =~ />/
-    if seq.length != 0
-      revcomp(seq.join)
-      seq=Array.new
-    end
-    puts $_
-  else
-    $_.sub(/\n/,'')
-    seq.push $_
-  end
-end
-revcomp(seq.join)
+#!/usr/bin/ruby
+# The Great Computer Language Shootout
+# http://shootout.alioth.debian.org/
+#
+# Contributed by Peter Bjarke Olsen
+# Modified by Doug King
+
+seq=Array.new
+
+def revcomp(seq)
+  seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+  stringlen=seq.length
+  0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+end
+
+input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+while input.gets
+  if $_ =~ />/
+    if seq.length != 0
+      revcomp(seq.join)
+      seq=Array.new
+    end
+    puts $_
+  else
+    $_.sub(/\n/,'')
+    seq.push $_
+  end
+end
+revcomp(seq.join)
diff --git a/bench/yarv/bm_so_sieve.rb → bench/mri/bm_so_sieve.rb b/bench/yarv/bm_so_sieve.rb → bench/mri/bm_so_sieve.rb
@@ -1,15 +1,15 @@
 # from http://www.bagley.org/~doug/shootout/bench/sieve/sieve.ruby
-num = 40
+num = 500
 count = i = j = 0
 flags0 = Array.new(8192,1)
 k = 0
 while k < num
-  k+=1
+  k += 1
   count = 0
   flags = flags0.dup
   i = 2
   while i<8192
-    i+=1
+    i += 1
     if flags[i]
       # remove all multiples of prime: i
       j = i*i

diff --git a/bench/yarv/bm_so_spectralnorm.rb → bench/mri/bm_so_spectralnorm.rb b/bench/yarv/bm_so_spectralnorm.rb → bench/mri/bm_so_spectralnorm.rb
@@ -1,50 +1,50 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org/
-# Contributed by Sokolov Yura
-
-def eval_A(i,j)
-	return 1.0/((i+j)*(i+j+1)/2+i+1)
-end
-
-def eval_A_times_u(u)
-        v, i = nil, nil
-	(0..u.length-1).collect { |i|
-                v = 0
-		for j in 0..u.length-1
-			v += eval_A(i,j)*u[j]
-                end
-                v
-        }
-end
-
-def eval_At_times_u(u)
-	v, i = nil, nil
-	(0..u.length-1).collect{|i|
-                v = 0
-		for j in 0..u.length-1
-			v += eval_A(j,i)*u[j]
-                end
-                v
-        }
-end
-
-def eval_AtA_times_u(u)
-	return eval_At_times_u(eval_A_times_u(u))
-end
-
-n = 500 # ARGV[0].to_i
-
-u=[1]*n
-for i in 1..10
-        v=eval_AtA_times_u(u)
-        u=eval_AtA_times_u(v)
-end
-vBv=0
-vv=0
-for i in 0..n-1
-        vBv += u[i]*v[i]
-        vv += v[i]*v[i]
-end
-
-str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
-# print str
+# The Computer Language Shootout
+# http://shootout.alioth.debian.org/
+# Contributed by Sokolov Yura
+
+def eval_A(i,j)
+	return 1.0/((i+j)*(i+j+1)/2+i+1)
+end
+
+def eval_A_times_u(u)
+        v, i = nil, nil
+	(0..u.length-1).collect { |i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(i,j)*u[j]
+                end
+                v
+        }
+end
+
+def eval_At_times_u(u)
+	v, i = nil, nil
+	(0..u.length-1).collect{|i|
+                v = 0
+		for j in 0..u.length-1
+			v += eval_A(j,i)*u[j]
+                end
+                v
+        }
+end
+
+def eval_AtA_times_u(u)
+	return eval_At_times_u(eval_A_times_u(u))
+end
+
+n = 500 # ARGV[0].to_i
+
+u=[1]*n
+for i in 1..10
+        v=eval_AtA_times_u(u)
+        u=eval_AtA_times_u(v)
+end
+vBv=0
+vv=0
+for i in 0..n-1
+        vBv += u[i]*v[i]
+        vv += v[i]*v[i]
+end
+
+str = "%0.9f" % (Math.sqrt(vBv/vv)), "\n"
+# print str
diff --git a/bench/yarv/bm_startup.rb → bench/mri/bm_startup.rb b/bench/yarv/bm_startup.rb → bench/mri/bm_startup.rb
diff --git a/bench/mri/bm_vm1_attr_ivar.rb b/bench/mri/bm_vm1_attr_ivar.rb
@@ -0,0 +1,14 @@
+class C
+  attr_reader :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = obj.a
+  k = obj.b
+end
diff --git a/bench/mri/bm_vm1_attr_ivar_set.rb b/bench/mri/bm_vm1_attr_ivar_set.rb
@@ -0,0 +1,14 @@
+class C
+  attr_accessor :a, :b
+  def initialize
+    @a = nil
+    @b = nil
+  end
+end
+obj = C.new
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  obj.a = 1
+  obj.b = 2
+end
diff --git a/bench/mri/bm_vm1_block.rb b/bench/mri/bm_vm1_block.rb
@@ -0,0 +1,10 @@
+def m
+  yield
+end
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m{
+  }
+end
diff --git a/bench/mri/bm_vm1_const.rb b/bench/mri/bm_vm1_const.rb
@@ -0,0 +1,8 @@
+Const = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = Const
+  k = Const
+end
diff --git a/bench/mri/bm_vm1_ensure.rb b/bench/mri/bm_vm1_ensure.rb
@@ -0,0 +1,11 @@
+i = 0
+while i<30_000_000 # benchmark loop 1
+  i += 1
+  begin
+    begin
+    ensure
+    end
+  ensure
+  end
+end
+
diff --git a/bench/mri/bm_vm1_float_simple.rb b/bench/mri/bm_vm1_float_simple.rb
@@ -0,0 +1,7 @@
+i = 0.0; f = 0.0
+while i<30_000_000
+  i += 1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+  f += 0.1; f -= 0.1
+end
diff --git a/bench/mri/bm_vm1_gc_short_lived.rb b/bench/mri/bm_vm1_gc_short_lived.rb
@@ -0,0 +1,10 @@
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_gc_short_with_complex_long.rb b/bench/mri/bm_vm1_gc_short_with_complex_long.rb
@@ -0,0 +1,27 @@
+def nested_hash h, n
+  if n == 0
+    ''
+  else
+    10.times{
+      h[Object.new] = nested_hash(h, n-1)
+    }
+  end
+end
+
+long_lived = Hash.new
+nested_hash long_lived, 6
+
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
+
diff --git a/bench/mri/bm_vm1_gc_short_with_long.rb b/bench/mri/bm_vm1_gc_short_with_long.rb
@@ -0,0 +1,13 @@
+long_lived = Array.new(1_000_000){|i| "#{i}"}
+GC.start
+GC.start
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_gc_short_with_symbol.rb b/bench/mri/bm_vm1_gc_short_with_symbol.rb
@@ -0,0 +1,15 @@
+# make many symbols
+50_000.times{|i| sym = "sym#{i}".to_sym}
+GC.start
+GC.start
+
+i = 0
+while i<30_000_000 # while loop 1
+  a = '' # short-lived String
+  b = ''
+  c = ''
+  d = ''
+  e = ''
+  f = ''
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_gc_wb_ary.rb b/bench/mri/bm_vm1_gc_wb_ary.rb
@@ -0,0 +1,12 @@
+short_lived_ary = []
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_ary[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_gc_wb_ary_promoted.rb b/bench/mri/bm_vm1_gc_wb_ary_promoted.rb
@@ -0,0 +1,14 @@
+long_lived = []
+
+if RUBY_VERSION > "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived[0] = short_lived # write barrier
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_gc_wb_obj.rb b/bench/mri/bm_vm1_gc_wb_obj.rb
@@ -0,0 +1,15 @@
+class C
+  attr_accessor :foo
+end
+short_lived_obj = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false)
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  short_lived_obj.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_gc_wb_obj_promoted.rb b/bench/mri/bm_vm1_gc_wb_obj_promoted.rb
@@ -0,0 +1,17 @@
+class C
+  attr_accessor :foo
+end
+long_lived = C.new
+
+if RUBY_VERSION >= "2.2.0"
+  3.times{ GC.start(full_mark: false, immediate_mark: true, lazy_sweep: false) }
+elsif
+  GC.start
+end
+
+i = 0
+short_lived = ''
+while i<30_000_000 # while loop 1
+  long_lived.foo = short_lived # write barrier
+  i+=1
+end
diff --git a/bench/mri/bm_vm1_ivar.rb b/bench/mri/bm_vm1_ivar.rb
@@ -0,0 +1,8 @@
+@a = 1
+
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  j = @a
+  k = @a
+end
diff --git a/bench/yarv/bm_vm1_ivar_set.rb → bench/mri/bm_vm1_ivar_set.rb b/bench/yarv/bm_vm1_ivar_set.rb → bench/mri/bm_vm1_ivar_set.rb
@@ -1,6 +1,6 @@
-i = 0
-while i<30_000_000 # while loop 1
-  i+= 1
-  @a = 1
-  @b = 2
-end
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  @a = 1
+  @b = 2
+end
diff --git a/bench/mri/bm_vm1_length.rb b/bench/mri/bm_vm1_length.rb
@@ -0,0 +1,9 @@
+a = 'abc'
+b = [1, 2, 3]
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a.length
+  b.length
+end
+
diff --git a/bench/mri/bm_vm1_lvar_init.rb b/bench/mri/bm_vm1_lvar_init.rb
@@ -0,0 +1,18 @@
+def m v
+  unless v
+    # unreachable code
+    v1 = v2 = v3 = v4 = v5 = v6 = v7 = v8 = v9 = v10 =
+    v11 = v12 = v13 = v14 = v15 = v16 = v17 = v18 = v19 = v20 =
+    v21 = v22 = v23 = v24 = v25 = v26 = v27 = v28 = v29 = v30 =
+    v31 = v32 = v33 = v34 = v35 = v36 = v37 = v38 = v39 = v40 =
+    v41 = v42 = v43 = v44 = v45 = v46 = v47 = v48 = v49 = v50 = 1
+  end
+end
+
+i = 0
+
+while i<30_000_000 # while loop 1
+  i += 1
+  m i
+end
+
diff --git a/bench/mri/bm_vm1_lvar_set.rb b/bench/mri/bm_vm1_lvar_set.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a = b = c = d = e = f = g = h = j = k = l = m = n = o = p = q = r = 1
+end
diff --git a/bench/mri/bm_vm1_neq.rb b/bench/mri/bm_vm1_neq.rb
@@ -0,0 +1,8 @@
+i = 0
+obj1 = Object.new
+obj2 = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  obj1 != obj2
+end
diff --git a/bench/mri/bm_vm1_not.rb b/bench/mri/bm_vm1_not.rb
@@ -0,0 +1,7 @@
+i = 0
+obj = Object.new
+
+while i<30_000_000 # while loop 1
+  i += 1
+  !obj
+end
diff --git a/bench/mri/bm_vm1_rescue.rb b/bench/mri/bm_vm1_rescue.rb
@@ -0,0 +1,7 @@
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  begin
+  rescue
+  end
+end
diff --git a/bench/mri/bm_vm1_simplereturn.rb b/bench/mri/bm_vm1_simplereturn.rb
@@ -0,0 +1,9 @@
+def m
+  return 1
+end
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  m
+end
+
diff --git a/bench/mri/bm_vm1_swap.rb b/bench/mri/bm_vm1_swap.rb
@@ -0,0 +1,8 @@
+a = 1
+b = 2
+i = 0
+while i<30_000_000 # while loop 1
+  i += 1
+  a, b = b, a
+end
+
diff --git a/bench/mri/bm_vm1_yield.rb b/bench/mri/bm_vm1_yield.rb
@@ -0,0 +1,10 @@
+def m
+  i = 0
+  while i<30_000_000 # while loop 1
+    i += 1
+    yield
+  end
+end
+
+m{}
+
diff --git a/bench/mri/bm_vm2_array.rb b/bench/mri/bm_vm2_array.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [1,2,3,4,5,6,7,8,9,10]
+end
diff --git a/bench/mri/bm_vm2_bigarray.rb b/bench/mri/bm_vm2_bigarray.rb
@@ -0,0 +1,106 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  a = [
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+    1,2,3,4,5,6,7,8,9,10,
+  ]
+end
diff --git a/bench/mri/bm_vm2_bighash.rb b/bench/mri/bm_vm2_bighash.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<60_000 # benchmark loop 2
+  i += 1
+  a = {0=>0, 1=>1, 2=>2, 3=>3, 4=>4, 5=>5, 6=>6, 7=>7, 8=>8, 9=>9, 10=>10, 11=>11, 12=>12, 13=>13, 14=>14, 15=>15, 16=>16, 17=>17, 18=>18, 19=>19, 20=>20, 21=>21, 22=>22, 23=>23, 24=>24, 25=>25, 26=>26, 27=>27, 28=>28, 29=>29, 30=>30, 31=>31, 32=>32, 33=>33, 34=>34, 35=>35, 36=>36, 37=>37, 38=>38, 39=>39, 40=>40, 41=>41, 42=>42, 43=>43, 44=>44, 45=>45, 46=>46, 47=>47, 48=>48, 49=>49, 50=>50, 51=>51, 52=>52, 53=>53, 54=>54, 55=>55, 56=>56, 57=>57, 58=>58, 59=>59, 60=>60, 61=>61, 62=>62, 63=>63, 64=>64, 65=>65, 66=>66, 67=>67, 68=>68, 69=>69, 70=>70, 71=>71, 72=>72, 73=>73, 74=>74, 75=>75, 76=>76, 77=>77, 78=>78, 79=>79, 80=>80, 81=>81, 82=>82, 83=>83, 84=>84, 85=>85, 86=>86, 87=>87, 88=>88, 89=>89, 90=>90, 91=>91, 92=>92, 93=>93, 94=>94, 95=>95, 96=>96, 97=>97, 98=>98, 99=>99, 100=>100, 101=>101, 102=>102, 103=>103, 104=>104, 105=>105, 106=>106, 107=>107, 108=>108, 109=>109, 110=>110, 111=>111, 112=>112, 113=>113, 114=>114, 115=>115, 116=>116, 117=>117, 118=>118, 119=>119, 120=>120, 121=>121, 122=>122, 123=>123, 124=>124, 125=>125, 126=>126, 127=>127, 128=>128, 129=>129, 130=>130, 131=>131, 132=>132, 133=>133, 134=>134, 135=>135, 136=>136, 137=>137, 138=>138, 139=>139, 140=>140, 141=>141, 142=>142, 143=>143, 144=>144, 145=>145, 146=>146, 147=>147, 148=>148, 149=>149, 150=>150, 151=>151, 152=>152, 153=>153, 154=>154, 155=>155, 156=>156, 157=>157, 158=>158, 159=>159, 160=>160, 161=>161, 162=>162, 163=>163, 164=>164, 165=>165, 166=>166, 167=>167, 168=>168, 169=>169, 170=>170, 171=>171, 172=>172, 173=>173, 174=>174, 175=>175, 176=>176, 177=>177, 178=>178, 179=>179, 180=>180, 181=>181, 182=>182, 183=>183, 184=>184, 185=>185, 186=>186, 187=>187, 188=>188, 189=>189, 190=>190, 191=>191, 192=>192, 193=>193, 194=>194, 195=>195, 196=>196, 197=>197, 198=>198, 199=>199, 200=>200, 201=>201, 202=>202, 203=>203, 204=>204, 205=>205, 206=>206, 207=>207, 208=>208, 209=>209, 210=>210, 211=>211, 212=>212, 213=>213, 214=>214, 215=>215, 216=>216, 217=>217, 218=>218, 219=>219, 220=>220, 221=>221, 222=>222, 223=>223, 224=>224, 225=>225, 226=>226, 227=>227, 228=>228, 229=>229, 230=>230, 231=>231, 232=>232, 233=>233, 234=>234, 235=>235, 236=>236, 237=>237, 238=>238, 239=>239, 240=>240, 241=>241, 242=>242, 243=>243, 244=>244, 245=>245, 246=>246, 247=>247, 248=>248, 249=>249, 250=>250, 251=>251, 252=>252, 253=>253, 254=>254, 255=>255, 256=>256, 257=>257, 258=>258, 259=>259, 260=>260, 261=>261, 262=>262, 263=>263, 264=>264, 265=>265, 266=>266, 267=>267, 268=>268, 269=>269, 270=>270, 271=>271, 272=>272, 273=>273, 274=>274, 275=>275, 276=>276, 277=>277, 278=>278, 279=>279, 280=>280, 281=>281, 282=>282, 283=>283, 284=>284, 285=>285, 286=>286, 287=>287, 288=>288, 289=>289, 290=>290, 291=>291, 292=>292, 293=>293, 294=>294, 295=>295, 296=>296, 297=>297, 298=>298, 299=>299, 300=>300, 301=>301, 302=>302, 303=>303, 304=>304, 305=>305, 306=>306, 307=>307, 308=>308, 309=>309, 310=>310, 311=>311, 312=>312, 313=>313, 314=>314, 315=>315, 316=>316, 317=>317, 318=>318, 319=>319, 320=>320, 321=>321, 322=>322, 323=>323, 324=>324, 325=>325, 326=>326, 327=>327, 328=>328, 329=>329, 330=>330, 331=>331, 332=>332, 333=>333, 334=>334, 335=>335, 336=>336, 337=>337, 338=>338, 339=>339, 340=>340, 341=>341, 342=>342, 343=>343, 344=>344, 345=>345, 346=>346, 347=>347, 348=>348, 349=>349, 350=>350, 351=>351, 352=>352, 353=>353, 354=>354, 355=>355, 356=>356, 357=>357, 358=>358, 359=>359, 360=>360, 361=>361, 362=>362, 363=>363, 364=>364, 365=>365, 366=>366, 367=>367, 368=>368, 369=>369, 370=>370, 371=>371, 372=>372, 373=>373, 374=>374, 375=>375, 376=>376, 377=>377, 378=>378, 379=>379, 380=>380, 381=>381, 382=>382, 383=>383, 384=>384, 385=>385, 386=>386, 387=>387, 388=>388, 389=>389, 390=>390, 391=>391, 392=>392, 393=>393, 394=>394, 395=>395, 396=>396, 397=>397, 398=>398, 399=>399, 400=>400, 401=>401, 402=>402, 403=>403, 404=>404, 405=>405, 406=>406, 407=>407, 408=>408, 409=>409, 410=>410, 411=>411, 412=>412, 413=>413, 414=>414, 415=>415, 416=>416, 417=>417, 418=>418, 419=>419, 420=>420, 421=>421, 422=>422, 423=>423, 424=>424, 425=>425, 426=>426, 427=>427, 428=>428, 429=>429, 430=>430, 431=>431, 432=>432, 433=>433, 434=>434, 435=>435, 436=>436, 437=>437, 438=>438, 439=>439, 440=>440, 441=>441, 442=>442, 443=>443, 444=>444, 445=>445, 446=>446, 447=>447, 448=>448, 449=>449, 450=>450, 451=>451, 452=>452, 453=>453, 454=>454, 455=>455, 456=>456, 457=>457, 458=>458, 459=>459, 460=>460, 461=>461, 462=>462, 463=>463, 464=>464, 465=>465, 466=>466, 467=>467, 468=>468, 469=>469, 470=>470, 471=>471, 472=>472, 473=>473, 474=>474, 475=>475, 476=>476, 477=>477, 478=>478, 479=>479, 480=>480, 481=>481, 482=>482, 483=>483, 484=>484, 485=>485, 486=>486, 487=>487, 488=>488, 489=>489, 490=>490, 491=>491, 492=>492, 493=>493, 494=>494, 495=>495, 496=>496, 497=>497, 498=>498, 499=>499, 500=>500,}
+end
diff --git a/bench/mri/bm_vm2_case.rb b/bench/mri/bm_vm2_case.rb
@@ -0,0 +1,14 @@
+i = 0
+while i<6_000_000 # while loop 2
+  case :foo
+  when :bar
+    raise
+  when :baz
+    raise
+  when :boo
+    raise
+  when :foo
+    i += 1
+  end
+end
+
diff --git a/bench/mri/bm_vm2_case_lit.rb b/bench/mri/bm_vm2_case_lit.rb
@@ -0,0 +1,19 @@
+i = 0
+@ret = [ "foo", true, false, :sym, 6, nil, 0.1, 0xffffffffffffffff ]
+def foo(i)
+  @ret[i % @ret.size]
+end
+
+while i<6_000_000 # while loop 2
+  case foo(i)
+  when "foo" then :foo
+  when true then true
+  when false then false
+  when :sym then :sym
+  when 6 then :fix
+  when nil then nil
+  when 0.1 then :float
+  when 0xffffffffffffffff then :big
+  end
+  i += 1
+end
diff --git a/bench/mri/bm_vm2_defined_method.rb b/bench/mri/bm_vm2_defined_method.rb
@@ -0,0 +1,9 @@
+class Object
+  define_method(:m){}
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/bench/mri/bm_vm2_dstr.rb b/bench/mri/bm_vm2_dstr.rb
@@ -0,0 +1,6 @@
+i = 0
+x = y = 'z'
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  str = "foo#{x}bar#{y}baz"
+end
diff --git a/bench/mri/bm_vm2_eval.rb b/bench/mri/bm_vm2_eval.rb
@@ -0,0 +1,6 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  eval("1")
+end
+
diff --git a/bench/mri/bm_vm2_method.rb b/bench/mri/bm_vm2_method.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m; m; m; m; m; m; m; m;
+end
diff --git a/bench/mri/bm_vm2_method_missing.rb b/bench/mri/bm_vm2_method_missing.rb
@@ -0,0 +1,12 @@
+class C
+  def method_missing mid
+  end
+end
+
+obj = C.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m; obj.m;
+end
diff --git a/bench/mri/bm_vm2_method_with_block.rb b/bench/mri/bm_vm2_method_with_block.rb
@@ -0,0 +1,9 @@
+def m
+  nil
+end
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m{}; m{}; m{}; m{}; m{}; m{}; m{}; m{};
+end
diff --git a/bench/mri/bm_vm2_mutex.rb b/bench/mri/bm_vm2_mutex.rb
@@ -0,0 +1,9 @@
+require 'thread'
+
+m = Mutex.new
+
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  m.synchronize{}
+end
diff --git a/bench/mri/bm_vm2_newlambda.rb b/bench/mri/bm_vm2_newlambda.rb
@@ -0,0 +1,5 @@
+i = 0
+while i<6_000_000 # benchmark loop 2
+  i += 1
+  lambda {}
+end
diff --git a/bench/yarv/bm_vm2_poly_method.rb → bench/mri/bm_vm2_poly_method.rb b/bench/yarv/bm_vm2_poly_method.rb → bench/mri/bm_vm2_poly_method.rb
@@ -12,9 +12,9 @@ def m
 o1 = C1.new
 o2 = C2.new
 
-i=0
-while i<6000000 # benchmark loop 2
+i = 0
+while i<6_000_000 # benchmark loop 2
   o = (i % 2 == 0) ? o1 : o2
   o.m; o.m; o.m; o.m; o.m; o.m; o.m; o.m
-  i+=1
+  i += 1
 end
Original file line number	Diff line number	Diff line change
		@@ -1 +1 @@
		distributionUrl=https://repo1.maven.org/maven2/org/apache/maven/apache-maven/3.3.1/apache-maven-3.3.1-bin.zip
		distributionUrl=https://repo1.maven.org/maven2/org/apache/maven/apache-maven/3.3.9/apache-maven-3.3.9-bin.zip
-Original file line number
+Diff line change
@@ @@ -6,6 +6,6 @@ def fact(n) @@
       end
     end
-.times{
+.times {
       fact(5000)
-    }
+    }
Original file line number	Diff line number	Diff line change
		@@ -0,0 +1,2 @@
		bug10761 = 10000.times.map { \|x\| x.to_f }
		100.times { Marshal.dump(bug10761) }
Original file line number	Diff line number	Diff line change
		@@ -0,0 +1 @@
		100000.times { Marshal.load(Marshal.dump(Time.now)) }