use done-testing()

cjfields · Aug 31, 2015 · b399be7 · b399be7
1 parent 7ff353d
commit b399be7
Show file tree

Hide file tree

Showing 17 changed files with 17 additions and 17 deletions.
diff --git a/t/Annotation/Annotation.t b/t/Annotation/Annotation.t
@@ -27,4 +27,4 @@ $simple.value = 0;
 is $simple.value, 0;
 is ~$simple, 'Value: 0';
 
-done();
+done-testing();
diff --git a/t/Grammar/FTLocation.t b/t/Grammar/FTLocation.t
@@ -32,4 +32,4 @@ ok(Bio::Grammar::FTLocation ~~ Grammar);
     is($complex_ct, 121);
 }
 
-done();
+done-testing();
diff --git a/t/Grammar/Fasta.t b/t/Grammar/Fasta.t
@@ -55,4 +55,4 @@ is($/.to, 804);
 # TODO: use File::Spec-like path
 ok( Bio::Grammar::Fasta.parsefile( './t/data/test.fasta' ) );
 
-done();
+done-testing();
diff --git a/t/Location/Simple.t b/t/Location/Simple.t
@@ -58,4 +58,4 @@ ok(!$loc.is-remote, 'is-remote');
 ok($loc.is-fuzzy, 'is-fuzzy');
 is($loc, '1..100>', 'Stringified');
 
-done();
+done-testing();
diff --git a/t/PrimarySeq.t b/t/PrimarySeq.t
@@ -252,4 +252,4 @@ $seq = Bio::PrimarySeq.new( display_id => ~ 0, seq => 'GATC' );
 
 is($seq.display_id, 0, "Bug #2864");
 
-done();
+done-testing();
diff --git a/t/Range.t b/t/Range.t
@@ -257,4 +257,4 @@ for %subtract_tests.keys.sort -> $set {
     }
 }
 
-done();
+done-testing();
diff --git a/t/Role/Aliased.t b/t/Role/Aliased.t
@@ -26,4 +26,4 @@ is($test.bar, 'Long time no see');
 
 # TODO: add role tests...
 
-done();
+done-testing();
diff --git a/t/Role/Describable.t b/t/Role/Describable.t
@@ -27,4 +27,4 @@ is($s.description, 'Goodbye, Mr. Bond');
 #$s.desc     = 'Frankly, my dear...'; # TODO: set via alias
 #is($s.description, 'Frankly, my dear...');
 
-done();
+done-testing();
diff --git a/t/Role/IO.t b/t/Role/IO.t
@@ -49,7 +49,7 @@ is($in.mode, 'r');
 is(MyIO.catfile('a', 'b', 'c'), $*SPEC.catfile('a', 'b', 'c'), 'catfile');
 is(MyIO.catdir('a', 'b', 'c'), $*SPEC.catdir('a', 'b', 'c'), 'catdir');
 
-done();
+done-testing();
 
 END {
     unlink('hi.txt') if 'hi.txt'.IO:e;

diff --git a/t/Role/Identifiable.t b/t/Role/Identifiable.t
@@ -35,4 +35,4 @@ is($s.namespace, 'GenBank');
 is($s.lsid_string, 'BioPerl6:GenBank:Foo');
 is($s.namespace_string, 'GenBank:Foo');
 
-done();
+done-testing();
diff --git a/t/Role/Pluggable.t b/t/Role/Pluggable.t
@@ -35,4 +35,4 @@ ok(1);
 
 MyTest.new.test();
 
-done();
+done-testing();
diff --git a/t/Role/Temp.t b/t/Role/Temp.t
@@ -116,4 +116,4 @@ my ($tfh,$tfile);
 #    }
 #}
 
-done();
+done-testing();
diff --git a/t/Root.t b/t/Root.t
@@ -38,4 +38,4 @@ eval-dies-ok('$n.throw("foo")');
 eval-dies-ok('$n.warn("foo")');
 lives-ok {$n.debug("foo")};
 
-done();
+done-testing();
diff --git a/t/SeqIO.t b/t/SeqIO.t
@@ -40,4 +40,4 @@ is($in.format-variant, 'old', 'variant');
 
 dies-ok {Bio::SeqIO.new(format  => "foo")}, 'dies with an unknown format';
 
-done();
+done-testing();
diff --git a/t/Tools/CodonTable.t b/t/Tools/CodonTable.t
@@ -183,4 +183,4 @@ is $seq.translate.seq, 'M-K--N';
 #ok my $cut = $io.next_data();
 #is $myCodonTable.reverse_translate_best($seq,$cut), 'GCCTGCGACGAGTTCGGCCACATCAAGCTGATGAACCCCCAGCGCTCCACCGTGTGGTAC';
 
-done();
+done-testing();
diff --git a/t/Tools/FTLocationParser.t b/t/Tools/FTLocationParser.t
@@ -23,4 +23,4 @@ while $fh.get -> $line {
 
 $fh.close;
 
-done();
+done-testing();
diff --git a/t/Types.t b/t/Types.t
@@ -36,4 +36,4 @@ ok('rna'      ~~ SeqAlphabet);
 ok('protein'  ~~ SeqAlphabet);
 ok('foo'     !~~ SeqAlphabet);
 
-done();
+done-testing();