Fixed bug where description was not updated as needed

bioperl · Nov 25, 2011 · 6b81602 · 6b81602
1 parent c60036f
commit 6b81602
Show file tree

Hide file tree

Showing 2 changed files with 23 additions and 12 deletions.
diff --git a/Bio/Seq/SimulatedRead.pm b/Bio/Seq/SimulatedRead.pm
@@ -102,14 +102,14 @@ use base qw( Bio::Seq::Quality Bio::LocatableSeq );
                -end       => 135      ,
                -strand    => 1        ,
             );
- Arguments: -reference  => Bio::SeqI, Bio::PrimarySeqI object representing the
-                           reference sequence to take the read from. See
-                           reference().
-            -errors     => Hashref representing the position of errors in the read
-                           See errors().
-            -mid        => String of a MID to prepend to the read. See mid().
-            -track      => Track where the read came from in the read description?
-                           See track().
+ Arguments: -reference   => Bio::SeqI, Bio::PrimarySeqI object representing the
+                            reference sequence to take the read from. See
+                            reference().
+            -errors      => Hashref representing the position of errors in the read
+                            See errors().
+            -mid         => String of a MID to prepend to the read. See mid().
+            -track       => Track where the read came from in the read description?
+                            See track().
             -coord_style => Define what coordinate system to use. See coord_style().
             All other methods from Bio::LocatableSeq are available.
  Returns  : new Bio::Seq::SimulatedRead object
@@ -354,7 +354,7 @@ sub _update_desc_mid {
       # Sequencing errors introduced in the read
       my $mid_str = "mid=".$mid;
       my $desc_str = $self->desc;
-      $desc_str =~ s/(strand=\S+)( mid=\S+)?/$1 $mid_str/g;
+      $desc_str =~ s/((position|strand)=\S+)( mid=\S+)?/$1 $mid_str/g;
       $self->desc( $desc_str );
    }
    return 1;
@@ -583,7 +583,7 @@ sub _update_desc_errors {
       }
       $err_str =~ s/,$//;
       my $desc_str = $self->desc;
-      $desc_str =~ s/(strand=\S+( mid=\S+)?)( errors=\S+)?/$1 $err_str/g;
+      $desc_str =~ s/((position|strand)=\S+( mid=\S+)?)( errors=\S+)?/$1 $err_str/g;
       $self->desc( $desc_str );
    }
    return 1;

diff --git a/t/Seq/SimulatedRead.t b/t/Seq/SimulatedRead.t
@@ -35,7 +35,7 @@ $ref4 = Bio::LocatableSeq->new( -id  => 'a_thaliana',
                                 -seq => 'CGTATTCTGAGGAGAGCTCT' );
 
 
-# Basic object
+## Basic object
 
 ok $read = Bio::Seq::SimulatedRead->new( );
 isa_ok $read, 'Bio::Seq::SimulatedRead';
@@ -203,12 +203,23 @@ is $read->desc, 'reference=human_id start=1 end=12 strand=+1 errors=6+G,6+G desc
 
 # More tracking tests
 
+ok $read = Bio::Seq::SimulatedRead->new( -reference => $ref, -mid => 'ACGT', -qual_levels => [], -coord_style => 'genbank' );
+is $read->desc, 'reference=human_id position=1..12 mid=ACGT description="The human genome"';
+
+ok $read->mid('AAAA');
+is $read->desc, 'reference=human_id position=1..12 mid=AAAA description="The human genome"';
+
+$errors = {};
+$errors->{'6'}->{'+'} = 'GG';
+ok $read->errors($errors);
+is $read->desc, 'reference=human_id position=1..12 mid=AAAA errors=6+G,6+G description="The human genome"';
+
 ok not($read->track(0)), 'track()';
 is $read->track, 0;
 is $read->desc, undef;
 ok $read->track(1);
 is $read->track, 1;
-is $read->desc, 'reference=human_id start=1 end=12 strand=+1 errors=6+G,6+G description="The human genome"';
+is $read->desc, 'reference=human_id position=1..12 mid=AAAA errors=6+G,6+G description="The human genome"';
 
 
 # qual_levels() method