Bio::Seq compliance with Bio::FeatureHolderI

bioperl · Mar 7, 2012 · a5bebe0 · a5bebe0
1 parent d0584ca
commit a5bebe0
Show file tree

Hide file tree

Showing 10 changed files with 56 additions and 25 deletions.
diff --git a/Bio/FeatureHolderI.pm b/Bio/FeatureHolderI.pm
@@ -116,14 +116,14 @@ sub get_SeqFeatures {
 
  Usage   : $feat->add_SeqFeature($subfeat);
            $feat->add_SeqFeature($subfeat,'EXPAND')
- Function: adds a SeqFeature into the subSeqFeature array.
+ Function: Add a SeqFeature into the subSeqFeature array.
            with no 'EXPAND' qualifer, subfeat will be tested
            as to whether it lies inside the parent, and throw
            an exception if not.
 
-           If EXPAND is used, the parent''s start/end/strand will
-           be adjusted so that it grows to accommodate the new
-           subFeature
+           If EXPAND is used and the object implements Bio::RangeI
+           (which is not guaranteed), the parent''s start/end/strand
+           will be extended so that the new subFeature can be accomodated.
  Example :
  Returns : nothing
  Args    : a Bio::SeqFeatureI object

diff --git a/Bio/Seq.pm b/Bio/Seq.pm
@@ -1123,19 +1123,34 @@ sub feature_count {
  Function: Adds the given feature object to the feature array of this
            sequence. The object passed is required to implement the
            Bio::SeqFeatureI interface.
+           The 'EXPAND' qualifier (see L<Bio::FeatureHolderI>) is supported, but
+           has no effect,
  Returns : 1 on success
- Args    : A Bio::SeqFeatureI implementing object, or an array of such objects.
+ Args    : A Bio::SeqFeatureI implementing object.
 
 =cut
 
 sub add_SeqFeature {
-   my ($self,@feat) = @_;
+   my ($self, @feat) = @_;
 
    $self->{'_as_feat'} = [] unless $self->{'_as_feat'};
 
-   foreach my $feat ( @feat ) {
+   if (scalar @feat > 1) {
+      $self->deprecated(
+         -message => 'Providing an array of features to Bio::Seq add_SeqFeature()'.
+                     ' is deprecated and will be removed in a future version. '.
+                     'Add a single feature at a time instead.',
+         -warn_version    => 1.007,
+         -throw_version   => 1.009,
+      );
+   }
+
+   for my $feat ( @feat ) {
+
+       next if $feat eq 'EXPAND'; # Need to support it for FeatureHolderI compliance
+
        if( !$feat->isa("Bio::SeqFeatureI") ) {
-           $self->throw("$feat is not a SeqFeatureI and that's what we expect...");
+           $self->throw("Expected a Bio::SeqFeatureI object, but got a $feat.");
        }
 
        # make sure we attach ourselves to the feature if the feature wants it
@@ -1179,7 +1194,7 @@ and work as one expects, building new Bio::Seq objects
 or other information as expected. See L<Bio::PrimarySeq>
 for more information.
 
-Sequence Features are B<not> transfered to the new objects.
+Sequence Features are B<not> transferred to the new objects.
 This is possibly a mistake. Anyone who feels the urge in
 dealing with this is welcome to give it a go.
 

diff --git a/Bio/SeqFeature/Tools/Unflattener.pm b/Bio/SeqFeature/Tools/Unflattener.pm
@@ -1518,7 +1518,7 @@ sub unflatten_seq{
    # modify the original Seq object - the top seqfeatures are now
    # the top features from each group
    $seq->remove_SeqFeatures;
-   $seq->add_SeqFeature(@top_sfs);
+   $seq->add_SeqFeature($_) foreach @top_sfs;
 
    # --------- FINISHED UNFLATTENING -------------
 

diff --git a/Bio/SeqIO/game/gameWriter.pm b/Bio/SeqIO/game/gameWriter.pm
@@ -177,7 +177,7 @@ sub write_to_game {
     # $self->_rearrange_hierarchies($seq, @gene_containers);
 
     # add back nested feats
-    $seq->add_SeqFeature( @nested_feats  );
+    $seq->add_SeqFeature( $_ ) foreach @nested_feats;
 
     my $atts  = {};
     my $xml = '';
@@ -295,7 +295,7 @@ sub _rearrange_hierarchies { #renamed to not conflict with Bio::Root::_rearrange
     }    
 
     push @addback, (@containers, grep { defined $_ } @genes );
-    $seq->add_SeqFeature(@addback);
+    $seq->add_SeqFeature($_) foreach @addback;
 }
 
 

diff --git a/Bio/SeqIO/interpro.pm b/Bio/SeqIO/interpro.pm
@@ -166,6 +166,8 @@ sub next_seq {
                   -seq_id => $protein_node->getAttribute('id') ),
 					} @locNodes;
 			foreach my $seqFeature (@seqFeatures){
+				$bioSeq->add_SeqFeature($seqFeature);
+
 				my $annotation1 = Bio::Annotation::DBLink->new;
 				$annotation1->database($matchNodes[$match]->getAttribute('dbname'));
 				$annotation1->primary_id($matchNodes[$match]->getAttribute('id'));
@@ -195,7 +197,6 @@ sub next_seq {
                                      $seqFeature->annotation->add_Annotation('dblink', $go_annotation);
                                  }
 			}
-			$bioSeq->add_SeqFeature(@seqFeatures);
 		}
 	}
 	my $accession = $protein_node->getAttribute('id');

diff --git a/Bio/SeqUtils.pm b/Bio/SeqUtils.pm
@@ -535,15 +535,19 @@ sub trunc_with_features{
     unless $seq->isa('Bio::SeqI');
     my $trunc=$seq->trunc($start, $end);
     my $truncrange=Bio::Range->new(-start=>$start, -end=>$end, -strand=>0);
-    #move annotations
+    # move annotations
     foreach my $key ( $seq->annotation->get_all_annotation_keys() ) {
 	foreach my $value ( $seq->annotation->get_Annotations($key) ) {
 	    $trunc->annotation->add_Annotation($key, $value);
 	}
     }
 
-    #move features
-    $trunc->add_SeqFeature(grep {$_=$self->_coord_adjust($_, 1-$start, $end+1-$start) if $_->overlaps($truncrange)} $seq->get_SeqFeatures);
+    # move features
+    foreach ( grep
+              { $_=$self->_coord_adjust($_, 1-$start, $end+1-$start) if $_->overlaps($truncrange) }
+              $seq->get_SeqFeatures ) {
+        $trunc->add_SeqFeature($_);   
+    }
     return $trunc;
 }
 
@@ -1316,7 +1320,9 @@ sub revcom_with_features{
     }
 
     #move features
-    $revcom->add_SeqFeature(map {$self->_feature_revcom($_, $seq->length)} reverse $seq->get_SeqFeatures);
+    for (map {$self->_feature_revcom($_, $seq->length)} reverse $seq->get_SeqFeatures) {
+        $revcom->add_SeqFeature($_);
+    }
     return $revcom;
 }
 

diff --git a/scripts/Bio-DB-GFF/bp_genbank2gff3.pl b/scripts/Bio-DB-GFF/bp_genbank2gff3.pl
@@ -1059,8 +1059,8 @@ sub filter {
         my $m = $f->primary_tag;
         push @sources, $f if ($m eq 'source'); # dgg? but leave in @feats ?
         push @feats, $f unless $filter =~ /$m/i;
-        }
-      $seq->add_SeqFeature(@feats) if @feats;
+      }
+      $seq->add_SeqFeature($_) foreach @feats;
     } else {
       for my $f ( $seq->get_SeqFeatures ){
         my $m = $f->primary_tag;

diff --git a/t/SeqTools/SeqUtils.t b/t/SeqTools/SeqUtils.t
@@ -362,7 +362,10 @@ my $feature5 = Bio::SeqFeature::Generic->new(
   -start       => 11,
   -end         => 20
 );
-$seq_obj->add_SeqFeature( $composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5);
+
+for ($composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5) {
+   $seq_obj->add_SeqFeature( $_ );
+}
 
 my $coll = Bio::Annotation::Collection->new;
 $coll->add_Annotation(
@@ -560,8 +563,10 @@ my $foo_seq_obj = Bio::Seq::Foo->new(
   -seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
   -display_id => 'seq1',
   -desc       => 'some sequence for testing'
-); 
-$foo_seq_obj->add_SeqFeature( $composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5);
+);
+for ($composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5) {
+    $foo_seq_obj->add_SeqFeature( $_ );
+}
 $foo_seq_obj->annotation($coll);
 
 dies_ok(

diff --git a/t/Tools/Analysis/Protein/Domcut.t b/t/Tools/Analysis/Protein/Domcut.t
@@ -75,6 +75,8 @@ SKIP: {
 
 	ok my $seq4 = Bio::Seq->new();
 	ok $seq2->primary_seq($meta2);
-	ok $seq2->add_SeqFeature(@res);
+	for (@res) {
+		ok $seq2->add_SeqFeature($_);
+	}
 	ok $seq2->primary_seq->named_submeta_text('Domcut', 1,2);
 }
diff --git a/t/Tools/Analysis/Protein/HNN.t b/t/Tools/Analysis/Protein/HNN.t
@@ -7,7 +7,7 @@ BEGIN {
 	use lib '.';
     use Bio::Root::Test;
 
-    test_begin(-tests => 13,
+    test_begin(-tests => 14,
 			   -requires_modules => [qw(IO::String LWP::UserAgent)],
 			   -requires_networking => 1);
 
@@ -35,7 +35,9 @@ SKIP: {
 
 	ok my $meta = $tool->result('meta');
 	ok my $seqobj = Bio::Seq->new(-primary_seq => $meta, display_id=>"a");
-	ok $seqobj->add_SeqFeature($tool->result('Bio::SeqFeatureI'));
+	for ( $tool->result('Bio::SeqFeatureI') ) {
+		ok $seqobj->add_SeqFeature($_);
+	}
 
 	test_skip(-tests => 2, -requires_module => 'Bio::Seq::Meta::Array');
 	is $meta->named_submeta_text('HNN_helix',1,2), '0 111';