Fixed 'missing sequence' problem with nested SubSeq objects

bioperl · Mar 14, 2012 · 93fc11b · 93fc11b
1 parent 6ebef81
commit 93fc11b
Show file tree

Hide file tree

Showing 3 changed files with 37 additions and 7 deletions.
diff --git a/Bio/SeqFeature/SubSeq.pm b/Bio/SeqFeature/SubSeq.pm
@@ -97,7 +97,8 @@ use base qw(Bio::SeqFeature::Generic);
  Usage   : my $subseq = Bio::SeqFeature::SubSeq( -start => 1, -end => 10, -strand => -1);
  Function: Instantiate a new Bio::SeqFeature::SubSeq feature object
  Args    : -seq      , the sequence object or sequence string of the feature (optional)
-           -template , attach the feature to the provided template (parent) sequence (optional). Note that you must specify the feature location to do this.
+           -template , attach the feature to the provided parent template sequence or feature (optional).
+                       Note that you must specify the feature location to do this.
            -start, -end, -location, -strand and all other L<Bio::SeqFeature::Generic> argument can be used.
  Returns : A Bio::SeqFeature::SubSeq object
 
@@ -122,9 +123,21 @@ sub new {
     }
     if ($template) {
         if ( not($self->start) || not($self->end) ) {
-            $self->throw('Could not attach SubSeq feature to template sequence because the SubSeq location was unknown.');
+            $self->throw('Could not attach feature to template $template because'.
+                         ' the feature location was not specified.');
         }
 
+        # Need to attach to parent sequence and then add sequence feature
+        my $template_seq;
+        if ($template->isa('Bio::SeqFeature::Generic')) {
+           $template_seq = $template->entire_seq;
+        } elsif ($template->isa('Bio::SeqI')) {
+           $template_seq = $template;
+        } else {
+           $self->throw("Expected a Bio::SeqFeature::Generic or Bio::SeqI object".
+                        " as template, but got '$template'.");
+        }
+        $self->attach_seq($template_seq);
         $template->add_SeqFeature($self);
 
     }

diff --git a/t/SeqFeature/SubSeq.t b/t/SeqFeature/SubSeq.t
@@ -4,13 +4,13 @@ BEGIN {
     use lib '.';
     use Bio::Root::Test;
 
-    test_begin(-tests => 32);
+    test_begin(-tests => 37);
 
     use_ok 'Bio::PrimarySeq';
     use_ok 'Bio::SeqFeature::SubSeq';
 }
 
-my ($subseq, $subseq_seq, $template);
+my ($subseq, $subseq_seq, $subsubseq, $subsubseq_seq, $template);
 
 
 # Basic SubSeq object
@@ -89,4 +89,21 @@ ok $subseq_seq = $subseq->seq;
 isa_ok $subseq_seq, 'Bio::PrimarySeq';
 is $subseq_seq->seq, 'AAAAACCCCCTTTTTGGGGG';
 
+
+# Sub SubSeq
+
+ok $subsubseq = Bio::SeqFeature::SubSeq->new(
+    -start    => 11,
+    -end      => 15,
+    -strand   => 1,
+    -template => $subseq,
+);
+is $subsubseq->length, 5;
+ok $subsubseq_seq = $subsubseq->seq;
+isa_ok $subsubseq_seq, 'Bio::PrimarySeq';
+is $subsubseq_seq->seq, 'CCCCC';
+
+
+# One-liner
+
 is( Bio::SeqFeature::SubSeq->new(-start=>11,-end=>30,-strand=>1,-template=>$template)->seq->seq, 'CCCCCAAAAAGGGGGTTTTT' );
diff --git a/t/Tools/AmpliconSearch.t b/t/Tools/AmpliconSearch.t
@@ -2,7 +2,7 @@ BEGIN {
     use lib '.';
     use Bio::Root::Test;
 
-    test_begin(-tests => 158);
+    test_begin(-tests => 160);
 
     use_ok 'Bio::PrimarySeq';
     use_ok 'Bio::SeqFeature::Primer';
@@ -46,8 +46,8 @@ is $amplicon->end, 56;
 is $amplicon->strand, 1;
 is $amplicon->seq->seq, 'AAACTTAAAGGAATTGACGGacgtacgtacgtGTACACACCGCCCGTacgtac';
 ok $primer = $amplicon->fwd_primer;
-###ok $primer_seq = $primer->seq;
-###is $primer_seq->seq, 'AAACTTAAAGGAATTGACGG';
+ok $primer_seq = $primer->seq;
+is $primer_seq->seq, 'AAACTTAAAGGAATTGACGG';
 is $primer->start, 4;
 is $primer->end, 23;
 is $primer->strand, 1;