Fixed problem with optional reverse primer read from file

bioperl · Mar 14, 2012 · edc8cae · edc8cae
1 parent 07dcf87
commit edc8cae
Show file tree

Hide file tree

Showing 2 changed files with 29 additions and 5 deletions.
diff --git a/Bio/Tools/AmpliconSearch.pm b/Bio/Tools/AmpliconSearch.pm
@@ -269,9 +269,10 @@ sub _set_primer {
 
  Title    : primer_file
  Usage    : my ($fwd, $rev) = $search->primer_file;
- Function : Get/set a sequence file to read the primer from. After reading the
-            file, the primers are set using fwd_primer() and rev_primer() and
-            returned.
+ Function : Get/set a sequence file to read the primer from. The first sequence
+            must be the forward primer, and the second is the optional reverse
+            primer. After reading the file, the primers are set using fwd_primer()
+            and rev_primer() and returned.
  Args     : Sequence file
  Returns  : Array containing forward and reverse primers as sequence objects.
 
@@ -299,6 +300,8 @@ sub primer_file {
    my $rev_primer = $in->next_seq;
    if (defined $rev_primer) {
       $rev_primer->alphabet('dna');
+   } else {
+      $rev_primer = '';
    }
 
    $in->close;

diff --git a/t/Tools/AmpliconSearch.t b/t/Tools/AmpliconSearch.t
@@ -2,7 +2,7 @@ BEGIN {
     use lib '.';
     use Bio::Root::Test;
 
-    test_begin(-tests => 160);
+    test_begin(-tests => 174);
 
     use_ok 'Bio::PrimarySeq';
     use_ok 'Bio::SeqFeature::Primer';
@@ -103,7 +103,7 @@ is $search->template->seq, 'acgAAACTTAAAGGAATTGACGGacgtacgtacgtGTACACACCGCCCGTac
 is $search->next_amplicon, undef;
 
 
-## Degenerate forward and reverse primers from file, single amplicon
+# Degenerate forward and reverse primers from file, single amplicon
 
 ok $search = Bio::Tools::AmpliconSearch->new(
    -template    => $seq,
@@ -121,6 +121,26 @@ is $amplicon->seq->seq, 'AAACTTAAAGGAATTGACGGacgtacgtacgtGTACACACCGCCCGT';
 is $search->next_amplicon, undef;
 
 
+# Forward primer only, in sequence file
+
+ok $search = Bio::Tools::AmpliconSearch->new(
+   -primer_file => test_input_file('forward_primer.fa'),
+), 'Forward primer from file';
+ok $search->template($seq);
+is $search->fwd_primer->seq, 'AAACTTAAAGGAATTGACGG';
+is $search->rev_primer, undef;
+ok $template_seq = $search->template;
+isa_ok $template_seq, 'Bio::Seq';
+is $template_seq->seq, 'acgAAACTTAAAGGAATTGACGGacgtacgtacgtGTACACACCGCCCGTacgtac';
+ok $amplicon = $search->next_amplicon;
+isa_ok $amplicon, 'Bio::SeqFeature::Amplicon';
+is $amplicon->start, 4;
+is $amplicon->end, 56;
+is $amplicon->strand, 1;
+is $amplicon->seq->seq, 'AAACTTAAAGGAATTGACGGacgtacgtacgtGTACACACCGCCCGTacgtac';
+is $amplicon = $search->next_amplicon, undef;
+
+
 # Multiple amplicons
 
 $seq = Bio::PrimarySeq->new(
@@ -406,3 +426,4 @@ is $search->template->seq, 'aCCCCgaTTTTTTgacgtacgtac';
 ok $amplicon = $search->next_amplicon;
 is $amplicon->seq->seq, 'CCCCgaTTTTTT';
 is $search->next_amplicon, undef;
+