Skip to content

Commit

Permalink
Squashed SeqUtils test warnings
Browse files Browse the repository at this point in the history
  • Loading branch information
@fangly
fangly committed Feb 26, 2012
1 parent c244f77 commit a1f736f
Showing 1 changed file with 48 additions and 48 deletions.
96 changes: 48 additions & 48 deletions t/SeqTools/SeqUtils.t
View file
Expand Up @@ -9,14 +9,14 @@ BEGIN {
use Bio::Root::Test;

test_begin(-tests => 125);
use_ok('Bio::PrimarySeq');
use_ok('Bio::SeqUtils');
use_ok('Bio::LiveSeq::Mutation');
use_ok('Bio::SeqFeature::Generic');
use_ok('Bio::Annotation::SimpleValue');
use_ok('Bio::Annotation::Collection');
use_ok('Bio::Annotation::Comment');

use_ok('Bio::PrimarySeq');
use_ok('Bio::SeqUtils');
use_ok('Bio::LiveSeq::Mutation');
use_ok('Bio::SeqFeature::Generic');
use_ok('Bio::Annotation::SimpleValue');
use_ok('Bio::Annotation::Collection');
use_ok('Bio::Annotation::Comment');
}

my ($seq, $util, $ascii, $ascii_aa, $ascii3);
Expand All @@ -29,8 +29,8 @@ $ascii3 =
'AlaAsxCysAspGluPheGlyHisIleXleLysLeuMetAsnPylProGlnArgSerThrSecValTrpXaaTyrGlx';

$seq = Bio::PrimarySeq->new('-seq'=> $ascii,
'-alphabet'=>'protein',
'-id'=>'test');
'-alphabet'=>'protein',
'-id'=>'test');

# one letter amino acid code to three letter code
ok $util = Bio::SeqUtils->new();
Expand All @@ -56,8 +56,8 @@ is (Bio::SeqUtils->seq3in($seq, $ascii3)->seq, $ascii_aa);
#

$seq = Bio::PrimarySeq->new('-seq'=> 'agctgctgatcggattgtgatggctggatggcttgggatgctgg',
'-alphabet'=>'dna',
'-id'=>'test2');
'-alphabet'=>'dna',
'-id'=>'test2');

my @a = $util->translate_3frames($seq);
is scalar @a, 3;
Expand Down Expand Up @@ -95,8 +95,8 @@ is( $valid_aa{'Cys'}, 'C');

my $string1 = 'aggt';
$seq = Bio::PrimarySeq->new('-seq'=> 'aggt',
'-alphabet'=>'dna',
'-id'=>'test3');
'-alphabet'=>'dna',
'-id'=>'test3');

# point
Bio::SeqUtils->mutate($seq,
Expand Down Expand Up @@ -173,7 +173,7 @@ my $ac3 = Bio::Annotation::Collection->new();
my $simple3 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'red'
), ;
);
$ac3->add_Annotation('simple',$simple3);
$seq3->annotation($ac3);

Expand All @@ -185,20 +185,20 @@ is scalar $seq1->annotation->get_Annotations, 3;

# seq features
my $ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);


my $ft3 = Bio::SeqFeature::Generic->new( -start => 3,
-end => 3,
-strand => 1,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);
-end => 3,
-strand => 1,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);

$seq2->add_SeqFeature($ft2);
$seq2->add_SeqFeature($ft3);
Expand Down Expand Up @@ -242,15 +242,15 @@ $ac3 = Bio::Annotation::Collection->new();
$simple3 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'red'
), ;
);
$ac3->add_Annotation('simple',$simple3);
$seq2->annotation($ac3);
$ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);
);


$ft3 = Bio::SeqFeature::Generic->new( -start => 5,
Expand All @@ -259,7 +259,7 @@ $ft3 = Bio::SeqFeature::Generic->new( -start => 5,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);
);
$seq2->add_SeqFeature($ft2);
$seq2->add_SeqFeature($ft3);

Expand Down Expand Up @@ -442,11 +442,11 @@ is (shift @fd1_notes, '10bp internal deletion between pos 10 and 11', 'got the e

my ($feature3_del) = grep ($_->primary_tag eq 'feat3', $product->get_SeqFeatures);
ok ($feature3_del, "feature3 is till present");
is ( ($feature3_del->start, $feature3_del->end), ($feature3->start - 10, $feature3->end - 10 ), 'a feature downstream of the deletion site is shifted entirely by 10nt to the left');
is_deeply ( [$feature3_del->start, $feature3_del->end], [$feature3->start - 10, $feature3->end - 10], 'a feature downstream of the deletion site is shifted entirely by 10nt to the left');

my ($feature4_del) = grep ($_->primary_tag eq 'feat4', $product->get_SeqFeatures);
ok ($feature4_del, "feature4 is till present");
is ( ($feature4_del->start, $feature4_del->end), ($feature4->start, $feature4->end), 'a feature upstream of the deletion site is not repositioned by the deletion');
is_deeply ( [$feature4_del->start, $feature4_del->end], [$feature4->start, $feature4->end], 'a feature upstream of the deletion site is not repositioned by the deletion');

my ($feature2_del) = grep ($_->primary_tag eq 'feat2', $product->get_SeqFeatures);
ok ($feature2_del, "feature2 is till present");
Expand All @@ -464,8 +464,8 @@ lives_ok(
},
"No error thrown when inserting a fragment into recipient sequence"
);
my ($seq_obj_comment) = $seq_obj->annotation->get_Annotations('comment');
my ($product_comment) = $product->annotation->get_Annotations('comment');
($seq_obj_comment) = $seq_obj->annotation->get_Annotations('comment');
($product_comment) = $product->annotation->get_Annotations('comment');
is( $seq_obj_comment, $product_comment, 'annotation of whole sequence has been moved to new molecule');

my ($composite_feat1_ins) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
Expand All @@ -479,12 +479,12 @@ ok ($subfeat1_ins, "sub-feature 1 of the composite feature is still present");
is ($subfeat1->end, 12, "the original end of sf1 is 12");
is ($subfeat1_ins->end, $subfeat1->end + $fragment_obj->length, "after insertion, the end of sf1 has been shifted by the length of the insertion");
isa_ok( $subfeat1_ins->location, 'Bio::Location::Split', 'sub-feature 1 (spans insertion site) is now split up and');
is (
($subfeat1->location->end_pos_type, $subfeat1->location->start_pos_type),
($subfeat1_ins->location->end_pos_type, $subfeat1_ins->location->start_pos_type),
is_deeply (
[$subfeat1->location->end_pos_type, $subfeat1->location->start_pos_type],
[$subfeat1_ins->location->end_pos_type, $subfeat1_ins->location->start_pos_type],
'the start and end position types of sub-feature1 have not changed'
);
my ($subfeat1_comment) = $subfeat1->annotation->get_Annotations('comment');
($subfeat1_comment) = $subfeat1->annotation->get_Annotations('comment');
my ($subfeat1_ins_comment) = $subfeat1_ins->annotation->get_Annotations('comment');
is( $subfeat1_comment, $subfeat1_ins_comment, 'annotation of subeature 1 has been moved to new molecule');
my @sf1ins_notes = $subfeat1_ins->get_tag_values('note');
Expand All @@ -493,20 +493,20 @@ is (shift @sf1ins_notes, '10bp internal insertion between pos 10 and 21', 'got t

my ($feature3_ins) = grep ($_->primary_tag eq 'feat3', $product->get_SeqFeatures);
ok ($feature3_ins, "feature3 is till present");
is (
($feature3_ins->start, $feature3_ins->end),
($feature3->start + $fragment_obj->length, $feature3->end + $fragment_obj->length ),
is_deeply (
[$feature3_ins->start, $feature3_ins->end],
[$feature3->start + $fragment_obj->length, $feature3->end + $fragment_obj->length],
'a feature downstream of the insertion site is shifted entirely to the left by the length of the insertion');

my ($feature4_ins) = grep ($_->primary_tag eq 'feat4', $product->get_SeqFeatures);
ok ($feature4_ins, "feature4 is till present");
is ( ($feature4_ins->start, $feature4_ins->end), ($feature4->start, $feature4->end), 'a feature upstream of the insertion site is not repositioned');
is_deeply ( [$feature4_ins->start, $feature4_ins->end], [$feature4->start, $feature4->end], 'a feature upstream of the insertion site is not repositioned');

my ($frag_feature1_ins) = grep ($_->primary_tag eq 'frag_feat1', $product->get_SeqFeatures);
ok( $frag_feature1_ins, 'a feature on the inserted fragment is present on the product molecule');
is(
($frag_feature1_ins->start, $frag_feature1_ins->end),
(12, 14),
is_deeply (
[$frag_feature1_ins->start, $frag_feature1_ins->end],
[12, 14],
'position of the feature on the insert has been adjusted to product coordinates'
);
is( $frag_feature1_ins->strand, $frag_feature1->strand, 'strand of the feature on insert has not changed');
Expand Down Expand Up @@ -545,15 +545,15 @@ my ($inserted_fragment_feature) = grep(
);

ok($inserted_fragment_feature, 'we have a feature annotating the ligated fragment');
is(
($inserted_fragment_feature->start, $inserted_fragment_feature->end),
(11,20),
is_deeply (
[$inserted_fragment_feature->start, $inserted_fragment_feature->end],
[11, 20],
'coordinates of the feature annotating the ligated feature are correct'
);

my ($fragment_feat_lig) = grep ($_->primary_tag eq 'frag_feat1', $product->get_SeqFeatures);
ok( $fragment_feat_lig, 'the fragment feature1 is now a feature of the product');
is( ($fragment_feat_lig->start, $fragment_feat_lig->end), (17,19), 'start and end of a feature on the fragment are correct after insertion with "flip" option');
is_deeply( [$fragment_feat_lig->start, $fragment_feat_lig->end], [17,19], 'start and end of a feature on the fragment are correct after insertion with "flip" option');

# test clone_obj option (create new objects via clone not 'new')
my $foo_seq_obj = Bio::Seq::Foo->new(
Expand Down

0 comments on commit a1f736f

Please sign in to comment.