Skip to content

Commit

Permalink
Ironing out a few things in PrimedSeq
Browse files Browse the repository at this point in the history
  • Loading branch information
@fangly
fangly committed Mar 6, 2012
1 parent cf80a37 commit 1fb2ae3
Show file tree
Hide file tree
Showing 2 changed files with 32 additions and 113 deletions.
104 changes: 14 additions & 90 deletions Bio/Seq/PrimedSeq.pm
View file
Expand Up @@ -65,6 +65,10 @@ you can also retrieve information about melting temperatures and what not on eac
of the primers and the amplicon. The L<Bio::Tools::Primer3> module uses PrimedSeq
objects extensively.
Note that this module does not simulate PCR. It assumes that the primers
will match in a single location on the target sequence and does not understand
degenerate primers.
=over
=item *
Expand All @@ -75,18 +79,16 @@ If the primers are specified as sequence objects, e.g. L<Bio::PrimarySeq> or
L<Bio::Seq>, they are first converted to L<Bio::SeqFeature::Primer> objects.
Their location on the target sequence is then calculated and added to the
L<Bio::SeqFeature::Primer> objects, which you can retrieve using the get_primer()
method. Note that this module does not simulate PCR. It assumes that the primers
will match in a single location on the target sequence and does not understand
degenerate primers.
method.
=item *
Providing primers as primer objects
Because of the limitations of specifying primers as sequence objects, the
recommended method is to provide L<Bio::SeqFeature::Primer> objects. Make sure
that the location of the primers on the target sequence is recorded in the
objects, or else, it will have be calculated.
recommended method is to provide L<Bio::SeqFeature::Primer> objects. If you did
not record the location of the primers in the primer object, it will be
calculated.
=back
Expand Down Expand Up @@ -194,21 +196,12 @@ package Bio::Seq::PrimedSeq;
use strict;
use Bio::SeqFeature::Primer;

###use base qw(Bio::Root::Root Bio::SeqFeature::Generic);
use base qw(Bio::Root::Root Bio::SeqI Bio::SeqFeature::Generic);
###use base qw(Bio::Root::Root Bio::SeqFeature::Generic);

#### need to be a bio::seqfeature::xxx because Bio::Tools::Primer3 calls the method add_tag_value on it
#### if we store features, can we do it like Bio::Assembly::Contig : use Bio::DB::SeqFeature::Store; # isa Bio::SeqFeature::CollectionI
### 3/ test using sequence object as primers, then let coordinates be calculated
### then test using primers returned and make sure results are the same
### 4/ make sure that the case where primers match partially is handled well
### 5/ call $self->get_primer instead of $self->{'left'} and $self->seq instead of $self->{'seq'}
### 6/ for consistency, have an get_primer() be aliased to primer()
### 7/ anything to do about orientation of reverse primer?
### 8/ when asking for amplicon and primers match the beginning and end of the
### target sequence, avoid creating a new object and link to $self->seq
### 9/ Bio::SeqI compliance... and should this be a Bio::Seq base instead?
use base qw(Bio::Root::Root Bio::SeqFeature::Generic);
# Since this module occupies the Bio::Seq::* namespace, it should probably
# inherit from Bio::Seq before it inherits from Bio::SeqFeature::Generic. But
# then, Bio::SeqI and Bio::SeqFeatureI both request a seq() method that return
# different things. So, being Bio::SeqI is incompatible with being Bio::SeqFeatureI


=head2 new
Expand Down Expand Up @@ -318,9 +311,6 @@ sub get_primer {

sub annotated_sequence {
my $self = shift;
####
# update doc
####
my $seq = $self->{'seq'}; ### clone??
$seq->add_SeqFeature($self->{'left'});
$seq->add_SeqFeature($self->{'right'});
Expand Down Expand Up @@ -447,70 +437,4 @@ sub _place_primers {
}


#=head2 _set_seqfeature

# Title : _set_seqfeature
# Usage : $self->_set_seqfeature()
# Function: An internal method to create Bio::SeqFeature::Generic objects
# for the primed seq
# Returns : Nothing
# Args : None
# Note : Internal use only. Should only call this once left and right
# primers have been placed on the sequence. This will then set
# them as sequence features so hopefully we can get a nice output
# with write_seq.

#=cut

#sub _set_seqfeature {
# my $self = shift;

## my $left = $self->{left};
## my $right = $self->{right};

## ###unless ($self->{left}->{PRIMER_LEFT} &&
## ### $self->{right}->{PRIMER_RIGHT}) {

## if ( not( $left->location && $right->location ) ) {
## $self->throw('Could not make an annotated sequence because primer location was missing from Bio::SeqFeature::Primer object.');
## }

## ###my ($start, $length) = split /,/, $self->{left}->{PRIMER_LEFT};

## my $start = $left->location + $left->start - 1;
## my $length = $left->end - $left->start + 1;
## my $strand = $left->strand;

## my $tm = $left->{PRIMER_LEFT_TM} || $left->Tm || 0;

## my $seqfeatureL = Bio::SeqFeature::Generic->new(
## -start => $start, ### + 1,
## -end => $start + $length,
## -strand => $strand,
## -primary_tag => 'left_primer',
## -source => 'primer3',
## -tag => {new => 1, author => 'Bio::Seq::PrimedSeq', Tm => $tm},
## );
##
## ###($start, $length) = split /,/, $self->{right}->{PRIMER_RIGHT};
## $start = $right->location + $right_location->start - 1;
## $strand = $right->strand;
## $tm = $right->{PRIMER_RIGHT_TM} || $right->Tm || 0;
##
## my $seqfeatureR = Bio::SeqFeature::Generic->new(
## -start => $start - $length + 2,
## -end => $start + 1,
## -strand => -1,
## -primary_tag => 'right_primer',
## -source => 'primer3',
## -tag => {new => 1, author => 'Bio::Seq::PrimedSeq', Tm => $tm},
## );

## # Now add the sequences to an annotated sequence
## $self->{annotated_sequence} = $self->{seq}; #### clone?
## $self->{annotated_sequence}->add_SeqFeature($seqfeatureL);
## $self->{annotated_sequence}->add_SeqFeature($seqfeatureR);

#}

1;
41 changes: 18 additions & 23 deletions t/Seq/PrimedSeq.t
View file
Expand Up @@ -8,7 +8,7 @@ BEGIN {
use lib '.';
use Bio::Root::Test;

test_begin(-tests => 36);
test_begin(-tests => 66);

use_ok('Bio::SeqIO');
use_ok('Bio::Seq::PrimedSeq');
Expand All @@ -19,11 +19,6 @@ my ($seqio, $seq, $left, $right, $primed_seq, $left_test, $right_test, $annseq,
$seqio = Bio::SeqIO->new(-file => test_input_file('primedseq.fa'));
$seq = $seqio->next_seq;

####
#print "Sequence length is: ".$seq->length."\n";
#print $seq->seq."\n";
####

my $expected_amplicon_seq = 'cttttcattctgactgcaacgGGCAATATGTCTCTGTGTGGATTAAAAA'.
'AAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAA'.
'TACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAacgcattagca'.
Expand All @@ -43,21 +38,10 @@ ok $primed_seq = Bio::Seq::PrimedSeq->new(
-right_primer => $right,
), 'Priming the target with sequence objects';

is $primed_seq->isa('Bio::SeqI'), 1;
is $primed_seq->isa('Bio::SeqFeature::Generic'), 1;

####
#use Data::Dumper;
#print "primed_seq: ".Dumper($primed_seq);
####

ok $annseq = $primed_seq->annotated_sequence; # should I check that this is what I think it is, or just be happy?

####
#use Data::Dumper;
#print "annseq: ".Dumper($annseq);
####

ok $amplicon = $primed_seq->amplicon;
is $amplicon->seq, $expected_amplicon_seq;
is $amplicon->id, 'Amplicon_from_Test1';
Expand Down Expand Up @@ -88,7 +72,7 @@ ok $primed_seq = Bio::Seq::PrimedSeq->new(
-left_primer => $left,
-right_primer => $right,
), 'Priming the target with primer objects';
ok $annseq = $primed_seq->annotated_sequence; # should I check that this is what I think it is, or just be happy?
ok $annseq = $primed_seq->annotated_sequence;
ok $amplicon = $primed_seq->amplicon;
is $amplicon->seq, $expected_amplicon_seq;
is $amplicon->id, 'Amplicon_from_Test1';
Expand All @@ -110,14 +94,25 @@ is $right_test->end, 210;


# Prime the sequence with Bio::SeqFeature::Primer objects
$left = Bio::SeqFeature::Primer->new(-id => 123, -seq => 'CTTTTCATTCTGACTGCAACG', -start => 10, -end => 30);
$right = Bio::SeqFeature::Primer->new(-seq => 'GGTGGTGCTAATGCGT', -start => 195, -end => 210);
$left = Bio::SeqFeature::Primer->new(
-id => 123,
-seq => 'CTTTTCATTCTGACTGCAACG',
-start => 10,
-end => 30,
-strand => 1,
);
$right = Bio::SeqFeature::Primer->new(
-seq => 'GGTGGTGCTAATGCGT',
-start => 195,
-end => 210,
-strand => -1,
);
ok $primed_seq = Bio::Seq::PrimedSeq->new(
-seq => $seq,
-left_primer => $left,
-right_primer => $right,
), 'Priming the target with located primer objects';
ok $annseq = $primed_seq->annotated_sequence; # should I check that this is what I think it is, or just be happy?
ok $annseq = $primed_seq->annotated_sequence;
ok $amplicon = $primed_seq->amplicon;
is $amplicon->seq, $expected_amplicon_seq2;
is $amplicon->id, 'Amplicon_from_Test1';
Expand All @@ -131,8 +126,8 @@ ok( ($left_test, $right_test) = $primed_seq->get_primer('-both') );
is_deeply $left_test, $left;
is_deeply $right_test, $right;
is $left_test->strand, 1;
is $left_test->start, 3;
is $left_test->end, 23;
is $left_test->start, 10;
is $left_test->end, 30;
is $right_test->strand, -1;
is $right_test->start, 195;
is $right_test->end, 210;

0 comments on commit 1fb2ae3

Please sign in to comment.