Saving current changes

bioperl · Mar 5, 2012 · 4c1046d · 4c1046d
1 parent 91a0c5a
commit 4c1046d
Show file tree

Hide file tree

Showing 3 changed files with 36 additions and 17 deletions.
diff --git a/Bio/SeqFeature/SubSeq.pm b/Bio/SeqFeature/SubSeq.pm
@@ -130,7 +130,10 @@ sub new {
            ### We should not have to use this :(
            $template->add_SeqFeature($self);
         } else {
-           $template->add_SeqFeature($self, 'EXPAND');
+           ####
+           #$template->add_SeqFeature($self, 'EXPAND');
+           $template->add_SeqFeature($self);
+           ####
         }
 
     }

diff --git a/Bio/Tools/AmpliconSearch.pm b/Bio/Tools/AmpliconSearch.pm
@@ -349,6 +349,8 @@ sub next_amplicon {
       }
    }
 
+#  # May want to use Bio::Range intersection() to check for overlap
+
 #  # Get amplicons from forward and reverse strand
 #  my $fwd_amplicons = _extract_amplicons_from_strand($seq, $fwd_regexp, $rev_regexp, 1);
 #  my $rev_amplicons = _extract_amplicons_from_strand($seq, $fwd_regexp, $rev_regexp, -1);
@@ -399,6 +401,12 @@ sub _attach_amplicon {
       -template => $self->template,
    );
 
+   ####
+   use Data::Dumper;
+   print "Amplicon: ".$amplicon->start." .. ".$amplicon->end." -> ".$amplicon->seq->seq."\n";
+   print "AMPLICON: ".Dumper($amplicon);
+   ####
+
    # Create Bio::SeqFeature::Primer feature and attach them to the amplicon
    if ($self->attach_primers) {
       for my $type ('fwd', 'rev') {
@@ -419,6 +427,11 @@ sub _attach_amplicon {
             $pstrand = -1 * $amplicon->strand;
          }
 
+         ####
+         $pstart += $start - 1;
+         $pend   += $start - 1;
+         ####
+
          Bio::SeqFeature::Primer->new(
             -start    => $pstart,
             -end      => $pend,
@@ -428,6 +441,12 @@ sub _attach_amplicon {
       }
    }
 
+   ####
+   use Data::Dumper;
+   print "Amplicon: ".$amplicon->start." .. ".$amplicon->end." -> ".$amplicon->seq->seq."\n";
+   print "AMPLICON: ".Dumper($amplicon);
+   ####
+
    return $amplicon;
 }
 

diff --git a/t/Tools/AmpliconSearch.t b/t/Tools/AmpliconSearch.t
@@ -2,17 +2,17 @@ BEGIN {
     use lib '.';
     use Bio::Root::Test;
 
-    test_begin(-tests => 118);
+    test_begin(-tests => 119);
 
-    use_ok 'Bio::Tools::AmpliconSearch';
     use_ok 'Bio::PrimarySeq';
     use_ok 'Bio::SeqFeature::Primer';
+    use_ok 'Bio::Tools::AmpliconSearch';
 }
 
 
 
 my ($search, $amplicon, $seq, $forward, $reverse, $primer, $primer_seq,
-    $annotated, $num_feats);
+    $annotated, $num_feats, $template_seq);
 
 
 # Basic object
@@ -32,23 +32,25 @@ $forward = Bio::PrimarySeq->new(
 ok $search = Bio::Tools::AmpliconSearch->new(
    -template       => $seq,
    -fwd_primer     => $forward,
-###   -attach_primers => 1,
+   -attach_primers => 1,
 ), 'Forward primer only';
 is $search->fwd_primer->seq, 'AAACTTAAAGGAATTGACGG';
 is $search->rev_primer, undef;
-is $search->template->seq, 'aaaAAACTTAAAGGAATTGACGGaaaaaaaaaaaaGTACACACCGCCCGTaaaaaa';
+ok $template_seq = $search->template;
+isa_ok $template_seq, 'Bio::Seq';
+is $template_seq->seq, 'aaaAAACTTAAAGGAATTGACGGaaaaaaaaaaaaGTACACACCGCCCGTaaaaaa';
 ok $amplicon = $search->next_amplicon;
 isa_ok $amplicon, 'Bio::SeqFeature::Amplicon';
 is $amplicon->start, 4;
 is $amplicon->end, 56;
 is $amplicon->strand, 1;
 is $amplicon->seq->seq, 'AAACTTAAAGGAATTGACGGaaaaaaaaaaaaGTACACACCGCCCGTaaaaaa';
-###ok $primer = $amplicon->fwd_primer;
-###ok $primer_seq = $primer->seq;
-###is $primer_seq->seq, 'AAACTTAAAGGAATTGACGG';
-###is $primer_seq->start, 1;
-###is $primer_seq->end, 20;
-###is $primer_seq->strand, 1;
+ok $primer = $amplicon->fwd_primer;
+ok $primer_seq = $primer->seq;
+is $primer_seq->seq, 'AAACTTAAAGGAATTGACGG';
+is $primer_seq->start, 1;
+is $primer_seq->end, 20;
+is $primer_seq->strand, 1;
 is $amplicon = $search->next_amplicon, undef;
 
 
@@ -340,11 +342,6 @@ $num_feats = 0;
 for my $feat ( $annotated->get_SeqFeatures ) {
    $num_feats++;
    isa_ok $feat, 'Bio::SeqFeature::Amplicon';
-
-   ####
-   print $feat->gff_string;
-   ####
-
 }
 is $num_feats, 2;
 is $search->next_amplicon, undef;